header pic

Area51 Board (non-moderated) at College Football Fan Site, CFB51!!!

The 'Old' Scout-Tennessee a51 Crowd- Enjoy ROWDY discussion covering politics, religion, current events, and all things under the sun

Anyone is welcomed and encouraged to join our FREE site and to take part in our community- a community with you- the user, the fan, -and the person- will be protected from intrusive actions and with a clean place to interact.


Author

Topic: Militant Atheist?

 (Read 5639 times)

P1tchBlack

  • Guest
Re: Militant Atheist?
« Reply #140 on: November 09, 2017, 01:47:24 PM »
Shame on you fuzz...

Pitch I don't know you very well, but shame on you too....
What did I do???

BrownCounty

  • All Star
  • ******
  • Posts: 3677
  • Liked:
Re: Militant Atheist?
« Reply #141 on: November 09, 2017, 01:56:17 PM »
"Unfortunately for theologians, supernaturalist con-men and religious hucksters, there's a growing percentage of the populace unwilling to bury their intellects in the sands of ancient myths."

I will assume you group me into one of the above epithets, so I only have one question which draws from your statement.

How is your sightless faith in man "unfortunate" for me?

Don't go to hell fighting a straw man.

BrownCounty

  • All Star
  • ******
  • Posts: 3677
  • Liked:
Re: Militant Atheist?
« Reply #142 on: November 09, 2017, 02:02:39 PM »
DD, thanks.  I read every word.  Interesting.

fuzzynavol

  • seeker of passage
  • Legend
  • ****
  • Posts: 8382
  • Liked:
Re: Militant Atheist?
« Reply #143 on: November 09, 2017, 02:13:23 PM »
"Unfortunately for theologians, supernaturalist con-men and religious hucksters, there's a growing percentage of the populace unwilling to bury their intellects in the sands of ancient myths."

How is your sightless faith in man "unfortunate" for me?

It's not just my rational "faith" in science - it's (increasingly) everyone's.  It's unfortunate that your irrational devoutness will leave you painted into an intellectual corner with the cave-dwellers of Afghanistan, worthy of no more respect or influence in the world.  

Don't go to hell fighting a straw man.

I don't need to invent a false enemy - I've got all the fodder I need using their own words.  

fuzzynavol

  • seeker of passage
  • Legend
  • ****
  • Posts: 8382
  • Liked:
Re: Militant Atheist?
« Reply #144 on: November 09, 2017, 02:17:26 PM »

BrownCounty

  • All Star
  • ******
  • Posts: 3677
  • Liked:
Re: Militant Atheist?
« Reply #145 on: November 09, 2017, 02:35:37 PM »
Fuzzy,

Your language connotates you are at war against somebody or something.  And you use words like "unfortunately for" so-in-so, to depict them as losers in your war.

I (and other believers) lose nothing as a result of your defiance.  I don't live in a cave in Afghanistan.  I live well and comfortably.  Very well.  Very comfortably.  I am happy.

You try to paint me as an outcast by emphasizing trends in Godlessness.  Hello... yes you're right.  I'm an outcast, and I'm certainly aware that it's not turning around.  Or else prophecy would have been wrong.  As a child I used to trouble with scriptures such as "this world is not your home", "do not love the world", etc...   I struggle with that no longer, it's all been made so clear.  Especially in America over the last 3-4 decades.  You gleefully fulfill what was told centuries ago, you fancy yourself as enlightened and superior for doing so, you walk right into the lion's den, and you are proud of it.  And literally, that will be your cross to bear.

If I saw a discussion debating the reality of the Easter Bunny, I would scroll on.  You would think that you otherwise intelligent people would at least ponder what lights your fire about something you don't even believe in.  Seems absurd.

DunkingDan

  • Global Moderator
  • Hall of Fame
  • *****
  • Posts: 18289
  • Liked:
Food for thought pt 1
« Reply #146 on: November 09, 2017, 02:56:56 PM »
All of this "day-age" and "interpretation" sounds like an attempt at retro-fitting Christianity to science.  "The Church" has gotten really good a explaining away all of the issues that have arisen from the bible.  Ultimately, there's no foundation for these explanations, because there's no factual basis for it.  It's really just a lot of spin.
The only one who is spinning is you as you do not like someone using actual meanings of the original words that was used in writing the various books of the Bible. Something one must keep in mind when reading the Bible and looking to what it means. Along with the culture, how words were use on context of the time (such as Shakespeare saying he knew her meaning he had intercourse with her), etc. Other things to keep in mind the Bible is not a science book, it is a book about a relationship between God and Man nothing more nothing less. The Old testament is primarily the foretelling of Christ and his life and the New testament is Christ revealed.

To say there is no factual basis to the Bible is to deny science as it points more and more each day for there being a creator and archelogy points more and more to the facts of some of the stories contained therein.

I don’t know if a creator did it a few thousand years back or billions of years ago and used Evolution or began different life’s as conditions permitted. Neither is relevant to what the Bible is saying to us. It is a mystery we will not know nor have the capability of understanding in this lifetime, this plane or this world  as are many other things.

The focus of this article is on the translation and meaning of the first 23 Hebrew words of Genesis. Understanding the grammar and meaning of those 23 words resolves long-standing disputes about the Bible's statement about the age of planet Earth and the age of the universe.
The Hebrew of some verses will be presented to allow the reader to verify the Hebrew word order of nouns and verbs. More often, a Hebrew word will be inserted into King James Version (KJV) verses in front of the English translation of that word. For example:
KJV Genesis 1:5And God called the light יום day, and the darkness He called night.
In some examples the Hebrew word יום and a phonetic pronunciation of that Hebrew word will be inserted to replace its English translation. For example:
KJV Genesis 1:5And God called the light יום "yom," and the darkness He called night.
The יום is the singular Hebrew word appearing in the Hebrew of the verse. The "yom" is a phonetic rendering of that Hebrew word. ("Yom" pronounces like "yome" rhyming with dome or home.)
The procedure followed in each specific instance is chosen to facilitate the reader's understanding of the translation issue or meaning of that verse. Another Hebrew word את, the direct object marker, has no equivalent in English and is not translated unless it has an attached preposition or ending. Because this article is brief, much supporting detail found in the longer work cannot be presented here.
Rodney Whitefield
Age of the Earth: Billions or Thousands?
What does the Bible say? Billions or Thousands?
Historically, the above question became important in the time period from the late 1700s through the early 1900s. By the early 1900s the major Christian groups had examined the text and found consistency between the statements of the first verses of the Bible and the geological and scientific findings of an old universe and an old planet Earth.
Among evangelical Christians, biblical consistency with an old planet Earth and an old universe was exemplified by the views of the writers of The Fundamentals in the early 1900s. These scholars held both long time (day-age) and 24-hour views of the six creative times, but were united in viewing the biblical text as being consistent with an old universe and an old planet Earth. By the mid-1950s, the 6,000 to 10,000 year old Earth view was held by only a small number of believers. In retrospect, the issue was considered so well settled that the upcoming new generation of pastors had been inadequately informed of the biblical basis for the consistency between the statements of the first verses of the Bible and the scientific findings of an old planet Earth.
Why is it Important?
The Bible claims to be truth.
If the Bible does not represent truth, or if those opposed to the teachings of Christianity can show that the Bible includes errors, the claims of Christianity are impaired.
If a group interprets the Bible in a manner different than that which the Hebrew text says, the truth claim of the Bible is impaired.
Today, the truth of the Bible is under serious attack based upon the claim, by some, that the Earth is only about 6,000 to 10,000 years old.
For evangelism, the issue is clear. Non-believers who decide to explore the Bible and the claims of Christ will typically start with the first page of the Bible. If the opponents of Christianity can impugn the truthfulness of the Bible on the first page, the claims of Christ may never be seriously considered.
This article will:
  • Show why the first verses of the Bible are consistent with an old Earth and an old universe.
  • Explain and refute the argument used to interpret the first verses of the Bible to arrive at a claimed 6,000 to 10,000 year old Earth and universe.
Key Issues about the Hebrew of Genesis 1:1-31
(The Key Issues will be discussed later in detail.)
Key Issue 1:The Text and Interpretation of Genesis 1:1
The Hebrew words of Genesis 1:1 are ordered in the sequence that Biblical Hebrew uses to indicate pluperfect action, i.e., expressed in English by verbs using the word "had."
Result:The Hebrew of Genesis 1:1 is properly translated as "had created," the English pluperfect tense. The consequence is that the creation described in Genesis 1:1 is already completed, a "done deal." See The Text and Interpretation of Genesis 1:1.
Key Issue 2:The Text and Interpretation of Genesis 1:2
The Hebrew words of Genesis 1:2 are also ordered in the sequence that Biblical Hebrew uses to indicate pluperfect action, i.e., expressed in English by verbs using the word "had."
Result:The Hebrew of Genesis 1:2 is properly translated as "had existed," "was existing," or "was" meaning "was already." Genesis 1:2 describes the state of planet Earth sometime after the creation of Genesis 1:1 but prior to the start of the sequence of commands modifying the environment. See The Text and Interpretation of Genesis 1:2.
Key Issue 3:When do Genesis 1:1 and Genesis 1:2 Happen?
Both Genesis 1:1 and Genesis 1:2 are completed before the "And God said. . ." command of Genesis 1:3. The command "And God said. . ." starts the first creative time period. Genesis 1:1 and Genesis 1:2 are not included within the first creative time period.
Result: Genesis 1:1 first describes the creation and then Genesis 1:2 describes the subsequent later condition of planet Earth before the first command of Genesis 1:3. Genesis 1:3 is the first command in a sequence of actions which modify the physical conditions and ecology of planet Earth. See When do Genesis 1:1 and Genesis 1:2 Happen?.
Key Issue 4:The Young Earth Argument about Genesis 1:1-2
Those advocating an Earth about 6,000 to 10,000 years old propose that Genesis 1: 1 and Genesis 1:2 are part of the first creative time period which starts with Genesis 1:3.
Answer: This argument depends on the presence of the word "in" in Exodus 20:11. The word "in" does not appear in the Hebrew of this verse. The word "in" is a word added to the verse by the KJV translators and was italicized to indicate that it had been added. The above argument also depends on an asserted equivalency of the Hebrew words "bara" (create) and "asah" (meaning do, or make). The writer of Genesis uses these two words in Genesis 2:3 in a manner which contradicts the claim of equivalency. See The “Young Earth” Argument about Genesis 1:1-2.
Key Issue 5:What About יום "Yom"? What Does יום "Yom" Mean?
Those advocating an Earth about 6,000 to 10,000 years old propose that the Hebrew word יום "yom" refers to a 24-hour day when used in Genesis 1:1-31, and therefore requires a 6,000 to 10,000 year old Earth.
Answer: This argument fails on many grounds. The word יום "yom" most commonly refers to the daytime. The second most common use of "yom" is to refer to long periods of time. The argument also fails because the universe and planet Earth are already in existence before the start of the first creative time period. See What About יום "Yom"? What Does יום "Yom" Mean?
What About יום "Yom"? What Does יום "Yom" Mean? for a more complete discussion of the word "yom."
Key Issue 1:
The Text and Interpretation of Genesis 1:1
Genesis 1:1 consists of seven Hebrew words. The Hebrew is shown below so that the sequence of the Hebrew words can be verified. Note: Hebrew reads from right to left. An English translation is given below each of the translated Hebrew words, and is also to be read from right to left. The analysis is a simplified version of the treatment in the author's book Reading Genesis One which can be consulted for a more detailed analysis. The purpose is to show the uncommon word order of the verse so that the reader may understand the significance by comparison with another well understood verse.
הארץואתאת השׁמיםאלהיםבראבראשׁיתGenesis 1:1
the Earthandthe heavensGod (Elohim)had createdin-beginningStart here.
The first word is בראשׁית "in-beginning," a word that is usually translated "In the beginning." This word is constructed by adding a prefix ב meaning "in" to the Hebrew word ראשׁ translated "beginning." The ending letters indicate pronunciation and indicate which words the word "in-beginning" refers to. In this case, the suffix indicates that the word in-beginning refers to the beginning of "the heavens and the Earth."
בראשׁית =תיראשׁבA Hebrew word starts here.
suffix"vowel"wordprefix
The second word is the verb ברא "bara" which means "had created." The verb ברא "bara" is in the Qal perfect (completed action) form. The Hebrew word "bara" has more than the basic meaning of create. "Bara" also carries the concept of making or creating something new. The completed action can be translated "had created," or "did create." If translated "created," the created must be understood as "created already" to reflect the Hebrew.
The important issue here is the word order, which places the Hebrew verb second in the sentence. The most common word order in a biblical Hebrew narrative places the verb first and places the subject of the verb second. Verb first word order appears in 28 of the first 31 verses of Genesis.
Placement of the verb as the second word of a sentence is one of the methods by which biblical Hebrew indicates already completed actions, which translate in English as the pluperfect. The pluperfect is the English verb form that uses "had." The verb second word order is used to give already completed background information at the beginning of a narrative, and for inserting other already completed information into a narrative as a comment or reminder of events which have already occurred.
For the purposes of this brief discussion we will consider and compare the similar construction, which occurs in the first verse of Job. Here again, the verb היה is the second word in the sentence. The subject אישׁ (A man) is the first word. Read from right to left.
האישׁוהיהשׁמואיובעוץבארץהיהאישׁJob 1:1
the manand had beenname ofJobUzin land ofhad existedA man Start here.
מרעוסראלהיםויראוישׁרתםההוא
from eviland turningGodfearingand uprightperfectthe same
Job is described as "perfect and upright," conditions that take considerable time to establish as the character and behavior of a person. Job's existence in this state is described in my translation under the Hebrew as "had existed." The completed action verb "had existed" correctly represents a considerable amount of past time, not a condition arrived at in an instant. The narrative of the story of Job begins in Job 1:2, a verse which starts with a verb. The KJV translates Job 1:1 as:
KJV Job 1:1There was a man in the land of Uz, whose name was Job; and that man was perfect and upright, and one that feared God, and eschewed evil.
The translators of the KJV have translated the first verb as "was," which can be understood correctly in this case as meaning "was already" because of the familiar human context. Young's Literal Translation (1865) more specifically recognized the already completed action meaning of the verb by translating the verb as "hath been."
Typically, the KJV translators used the simple English past tense for the completed action Hebrew verbs. They did not recognize, or were unaware of, the pluperfect significance of the biblical Hebrew "verb second" word order. The KJV does not preserve the Hebrew word order. The KJV translation alters the word order to correspond with the subject first practice of English, thereby removing the location (first or second) of the Hebrew verb from the reader's view. This practice has been continued in other later English translations of the Bible.
The important conclusion is that Genesis 1:1 describes already completed background information. Genesis 1:1 presents the creation of the universe and planet Earth as an already completed fact, albeit that the Earth is not in the final condition that we observe today.
English Tense and Hebrew Verb Translation
What are the issues? What is tense?
English speakers use tense every time they speak. It is a natural part of the English language. Since many readers will not have thought about tense since high school, we will first describe tense and then illustrate tense by examples.
Tense, in English, means that the form and placement of verbs tell the reader the "when" of the actions, the sequence of the actions, and sometimes the "duration" of the actions.
Verbs in biblical Hebrew do not tell the reader the "when" and sequence of actions by the form of the verb! Additional factors are involved in determining the English verb used for translation. Not all languages have tenses like English. Chinese is an example of a language which does not use tensed verb forms. This does not mean that Chinese speakers cannot convey the when, sequence, or duration of an action. They can, and do, but that information is not conveyed by the verb form. [Note: Verbs in modern Hebrew, as used in Israel today, do act much like English verbs. Modern Hebrew also has subject first word order.]
English past tense examples: when and sequence
In order to illustrate issues associated with tense in biblical Hebrew translation we shall first consider the two sentences shown below. The example refers to the familiar activity of baking, carried out by the person, Rose, who is the baker.
(1) Last Friday Rose baked cake;Rose had baked the bread.
Past (completed)Pluperfect (completed)
In (1) the pluperfect tense "had baked" is used with the simple past tense "baked." Both "baked" and "had baked" are completed actions. The "had" in this example informs the reader that the bread had been baked and was done (completed) before the cake (also completed). Now consider (2) which uses the simple past tense baked.
(2) Entering the kitchen, Rose baked cake. (in process)
The reader sees Rose entering the kitchen and engaging in the process of baking the cake.
English translation of biblical Hebrew usually translates completed action Hebrew verbs using the simple past tense. The effect that practice can have in altering the meaning of the translated text can be illustrated by replacing the had baked of line (1) by baked, yielding sentence (3):
(3) Last Friday Rose baked cake; Rose baked the bread.
In sentence (3), the correct order of the actions specified in example (1) has been lost.
What does this mean for translation?
Verbs in biblical Hebrew only indicate that an action is complete (finished) or incomplete (not finished). In biblical Hebrew the verb itself does not specify the duration of verbal actions, and it does not convey the time ordering of verbal actions. Biblical Hebrew does sometimes indicate the ordering of past actions. It does this not by verb forms but by word order, and several other means. This limitation is very important when reading Genesis.
The meaning of Genesis 1:1 and Genesis 1:2
In the discussion of Genesis 1:1, the verb was translated "had created" to correctly express the completed action meaning of the Hebrew verb, rather than the typical translation "created."
Why? Because of the word order. Most Hebrew sentences in a continuing narrative (story) start with a verb that is typically translated using the English past tense. As in example (2) using "baked," an English reader can interpret the completed action as an action occurring in the immediate past, just an instant ago. Such a meaning is not the meaning conveyed by the Hebrew word order in Genesis 1:1 and Genesis 1:2.
The pluperfect significance of the "subject before the verb" was known in the 1800s, but a more comprehensive understanding of "verb second" word order use in biblical Hebrew has only been attained within the past forty years. The more comprehensive understanding includes verbs that follow several types of initial words or non-verbal clauses. Because the "when" of the creation in Genesis 1:1 and Genesis 1:2 has become a significant issue, the Hebrew verb meaning needs to be expressed with great care.
A particularly clear statement regarding tense translation is quoted below. The quotation is from A Short Account of the Hebrew Tenses by R. H. Kennett (Cambridge: At the University Press, 1901, page 1).
The 'name' tenses as applied to Hebrew verbs is misleading. The so-called Hebrew 'tenses' do not express the time but merely the state of the action. Indeed were it not for the confusion that would arise through the application of the term 'state' to both nouns and verbs, 'states' would be a far better designation than 'tenses.' It must always be born in mind that it is impossible to translate a Hebrew verb into English without employing a limitation (viz. of time) which is entirely absent in Hebrew. The ancient Hebrews never thought of an action as past, present, or future, but simply as perfect, i.e., complete, or imperfect, i.e., as in course of development.
Readers wishing to understand tense translation in greater detail are advised to consult the author's book Reading Genesis One, and the references therein.
Key Issue 2:
The Text and Interpretation of Genesis 1:2
Similarly to Genesis 1:1, it will now be shown that Genesis 1:2 describes the condition of planet Earth as an already completed condition, the condition in which the Earth exists before the "And God said" of Genesis 1:3.
Genesis 1:2 consists of three clauses. We will examine the Hebrew of the first clause because the first clause contains the verb היתה as the second word of the sentence indicating pluperfect background information.
ובהותהוהיתהוהארץGenesis 1:2
and "bohu""tohu"had existedand the Earth Hebrew starts here.
The first word is ארץ = והארץ "earth" + ה "the" + ו "and" or "now."
The second word is the verb היתה. This verb means "to be," "to exist," "to become," or "to happen." The Qal perfect verb represents a completed action. The word order indicates that the completed action is to be translated "had existed," "had been," "existed," or "was." Translated "was," the meaning is equivalent to "was already." The suffix ה of היתה indicates that והארץ "and the Earth" is the subject of the verb.
The translation under the Hebrew of the last two of the first four words of Genesis 1:2 has been rendered "tohu" and "bohu." These are phonetic equivalents of the two Hebrew words. The proper translation of these words has posed considerable difficulty for translators, and is extensively discussed in the author's longer book Reading Genesis One. For this simplified treatment we will only consider the KJV translation and Young's Literal Translation (YLT). These differ in their translation of line (1), and of the two, "waste and void" would be preferred.
KJV Genesis 1:2(1) And the earth was without form, and void;
 (2) and darkness was upon the face of the deep.
 (3) And the Spirit of God moved upon the face of the waters.
YLT Genesis 1:2(1) the earth hath existed waste and void,
 (2) and darkness is on the face of the deep,
 (3) and the Spirit of God fluttering on the face of the waters,
In the Hebrew, clauses (2) and (3) do not contain a finite verb, and are termed "verbless clauses." Their location in time is determined by line (1) to which they refer. The verbs was and is, appearing in clause (2) of the above translations, are italicized to indicate that they were added by the translator. The verb "moved" in the KJV third clause represents a participle "moving," which the YLT renders "fluttering."
The prefix ו of the first Hebrew word of Genesis 1:2 represents the "and," which here has a disjunctive effect, indicating a change of scene. The "heavens and the Earth" have been completed. Now, in Genesis 1:2 the scene has changed from the entire universe to "the face of the deep." The participant has changed from God to "the Spirit of God." The action also changes from creation (bara) to moving over face of waters. Genesis 1:2 is a statement about planet Earth relating the background conditions necessary for understanding the events of Genesis 1:3-4.
We will now consider Genesis 3:1, the first verse in the narrative about Eve and the serpent. Genesis 3:1 is an example that illustrates the pluperfect background meaning of the first clause (1) of Genesis 1:2 and the disjunctive effect of the "And the Earth." The KJV translation of this verse is given below followed by the Hebrew with the corresponding KJV words.
KJV Genesis 3:1Now the serpent was more subtil than any beast of the field which the LORD God had made. And he said unto the woman, Yea, hath God said, Ye shall not eat of every tree of the garden?
השׂדהחיתמכלערוםהיהוהנחשׁGenesis 3:1
of the fieldbeastthan anymore subtilwasNow the serpent
The first Hebrew word of Genesis 3:1 is the noun for "serpent" prefixed by ו a prefix which translates "and" or "now." The "Now the serpent" acts in the same disjunctive manner as "And the Earth" does in Genesis 1:2. The first clause signals that the previous narrative has ended, the scene is now changed from that of the previous narrative, and some time has passed. The first clause states already completed background information about the serpent. This information is needed for understanding the new narrative which begins with the verb translated "And he said."
The second Hebrew word היה is the same verb as the second word of Genesis 1:2, but differs in form because it is of masculine gender to refer to the serpent. In the KJV of Genesis 3:1, the already completed meaning of "was" is more apparent due to the following pluperfect "had made." The disjunctive meaning of the Hebrew prefix ו is also more apparent because of the translation "Now." The disjunctive meaning in Genesis 1:2 is recognized in recent translations (such as the NIV) by translating "Now the Earth..." Other recent translations, including the NKJ, adopt the "The earth..." as used in Young's Literal Translation.
Important conclusions:
Genesis 1:1 and Genesis 1:2 describe already completed background information.
The "And the Earth" in Genesis 1:2 indicates that some time has elapsed since the creation of the heavens and the Earth in Genesis 1:1.
Key Issue 3:
When do Genesis 1:1 and Genesis 1:2 Happen?
In Genesis 3:1, about Eve and the snake, the first part of the verse gives background information about the serpent and his nature. These facts were already completed and known before the snake's initial action, "And he said unto the woman." The sequential narrative of the following events then starts with the Hebrew verb ויאמר "And he said." This same Hebrew verb, "and he said," is also used as the first word of Genesis 1:3, which also starts a sequential narrative.
The parallels of the verb use in Genesis 3:1 and Genesis 1:2-3 demonstrate the following: The "And the Earth was" of the KJV Genesis 1:2 must describe a condition of the Earth already completed and existing before the start of the narrative in Genesis 1:3.
The "when" of this completed condition is the same as that described by the translation "had existed," or by the translation "was" when understood as meaning "was already." The Hebrew perfect completed action verb does not indicate how long the Earth had been in this state, when this completed state had been achieved, or how long the Earth continues in this state before the command of Genesis 1:3.
As a consequence, Genesis 1:2 places no restriction on the age of the Earth or on the age of the universe. That Genesis 1:2 places no restriction on the age of the Earth is well-known to those of the Christian community who hold an Old Earth view of Genesis One.
The argument used to ignore the completed action meaning of Genesis 1:2 erroneously asserts that the events of Genesis 1:1 and Genesis 1:2 are not background information. This argument will be later examined in detail.
In order to provide a coherent exposition of the meaning of Genesis 1:2 as it relates to the age of the Earth, this study will now present another analysis, which shows that Genesis 1:2 is completed before the start of the first creative period. Because this study has not yet investigated the meaning of יום "yom" (commonly translated day), "yom" will be used in referring to the creative periods. The result of the analysis presented here does not depend on the length of time attributed to the creative yom.
The method of analysis is to follow the pattern of the ending and starting of the six creative periods, working backward from the completion of the sixth period. The completion of the sixth period is recorded in Genesis 2:1 as: "Thus the heavens and the earth were finished, ...."
There are two recurring patterns in Genesis 1:1-31. In the KJV these are:
  • Each of the six creative periods (creative "yom") ends with a phrase which starts with:
     KJV "And the evening and the morning were . . . "
  • Each of the six creative periods (creative "yom") begins with a sentence which starts with:
     KJV "And God said . . . "
Analysis Showing Genesis 1:3 is the Start of the First Creative יום "Yom"
Step 1 the end of the sixth "creative yom" is Genesis 1:31
end 1:31 And the evening and the morning were . . . KJV
 start 1:24 And God said . . .
Step 2 the end of the fifth "creative yom" is Genesis 1:23
end 1:23 And the evening and the morning were . . . KJV
 start 1:20 And God said . . .
Step 3 the end of the fourth "creative yom" is Genesis 1:19
end 1:19 And the evening and the morning were . . . KJV
 start 1:14 And God said . . .
Step 4 the end of the third "creative yom" is Genesis 1:13
end 1:13 And the evening and the morning were . . . KJV
 start 1:9 And God said . . .
Step 5 the end of the second "creative yom" is Genesis 1:8
end 1:8 And the evening and the morning were . . . KJV
 start 1:6 And God said . . .
Step 6 the end of the first "creative yom" is Genesis 1:5
end 1:5 And the evening and the morning were . . . KJV
 start 1:3 And God said . . .
 This command starts the first creative "yom." By pattern, in every case, the verses before each "And God said . . ." are not included in that creative "yom."
Genesis 1:1 and Genesis 1:2 have taken place, and are completed, before the start of the first creative "yom." The duration of Genesis 1:1 is not stated, only that the creation has occurred and has been completed. The time interval between Genesis 1:1 and Genesis 1:2 is not stated. The grammatical existence of this unstated time interval was well-known in the 1800s and early 1900s. There is also an unstated and unknown time interval between Genesis 1:2 and Genesis 1:3.
The significance of these time intervals is that the Bible makes no statement about the age of the universe or the age of planet Earth. As a consequence, the biblical text is consistent with an old universe and an old Earth, both billions of years old.
The Bible does make a statement about a beginning to the universe, a fact which science has grudgingly now accepted, thereby attesting to the truth of the first testable truth statement of the Bible.
Key Issue 4:
The Young Earth Argument about Genesis 1:1-2
In the previous sections it has been shown that Genesis 1:1-2 places no limit on the age of the Earth or on the age of the universe. Nevertheless, there are people who contest the issue and assert that the Bible says that the Earth and universe are about 6,000 to 10,000 years old. The argument is typically made by quoting the first part of Exodus 20:11, which is shown below.
KJV Exodus 20:11For in six days (yoms) the LORD made (asah) heaven and earth, the sea, and all that {is} in them, and rested the seventh day: . . .
The advocate then notes that both heaven and Earth are mentioned and said to have been made "in six days." The "in" is interpreted as placing all the making of heaven and Earth within the six creative times. Subsequently, it is asserted that the "asah" of Exodus 20:11 includes the "bara" creation of Genesis 1:1. This assertion is based on a claimed full equivalence of "bara" (the word used in Genesis 1:1) and "asah," making these different Hebrew words interchangeable. In fact, both of these argumentative steps fail for reasons (1) and (2) as explained below.
(1) The assertion based on the word in fails. The word "in" does not appear in the Hebrew text of Exodus 20:11 (or Exodus 31:17). The word "in" is a word added by the KJV translators. The KJV writes the word "in" in italics indicating that this word does not exist in the Hebrew text. But, the "in" is not italicized in most other English translations or in some recent printings of the KJV. Typically, the reader of Exodus 20:11 is unaware that the "in" is not in the Hebrew text. The insertion of the word "in" into the translation of Exodus 20:11 significantly distorts the meaning. The absence of the "in" removes the interpretation that all making must take place within the six creative times and voids the asserted inclusion of the "bara" of Genesis 1:1.
YLT Exodus 20:11for six days (yoms) hath Jehovah made (asah) the heavens and the earth, the sea, and all that {is} in them, . . .
KJV Exodus 20:11 For in six days (yoms) the LORD made (asah) heaven and earth, . . .
הארץואתהשׁמיםאתיהוהעשׂהימיםשׁשׁתכיExodus 20:11
the earthandthe heavensYahwehhad made"yoms"sixFor
בםאשׁרכלואתהיםאת
in themwhichallandthe sea
Young's Literal Translation (YLT) omits the word "in" and translates the verb עשׂה "asah" as a completed action by inserting the word "hath" before Jehovah. The accuracy of the YLT is verified by the Hebrew, shown with its literal translation for the portion of the verse in question.1

Conclusion from (1):The Hebrew of Exodus 20:11 does not support placing the "bara" creation of Genesis 1:1 into the six creative time periods.
Conclusion from (2).The assertion that "bara" (the word used in Genesis 1:1) and asah (the word used in Exodus 20:11) are fully equivalent and interchangeable also fails.

Consider Genesis 2:3, a verse which uses both ברא "bara" (create) and עשׂה "asah" (made) with respect to the Genesis creation story. The difference in meaning is clear but requires careful explanation of the KJV translation of the Hebrew infinitive לעשׂות "to make" and the KJV margin note. In Genesis 2:3 below, the YLT translation "for making" is correct.
YLT Gen. 2:3And God blesseth the seventh day, and sanctifieth it, for in it He hath ceased from all His work which God had prepared (bara) for making.
KJV Gen. 2:3And God blessed the seventh day, and sanctified it: because that in it he had rested from all his work which God created (bara) and made†.
 †Heb. created to make. (This is a margin note in the 1611 KJV.)
Genesis 2:3
כיאתוויקדשׁהשׁביעייוםאתאלהיםויברך(1)
becauseitand sanctifiedthe seventh"yom"Godand blessed
לעשׂותאלהיםבראאשׁרמלאכתומכלשׁבתבו(2)
"for making" or "to make"Godhad created (bara)whichhis workfrom allhe had ceasedin it
Line (2) of the Hebrew uses ברא "bara," which is followed by לעשׂות "asah" in an infinitive form translated "for making." The infinitive also means "to make" as indicated by the KJV margin note. The "to make" indicated by the word לעשׂות "asah" takes place after the completed action "had created." Not only does the text indicate that "bara" and "asah" have different meanings, but it indicates that the subsequent "makings" followed the creating by intent!
The translation of לעשׂות (asah) as "for making" or as the "to make" of the KJV margin note is correct for the following reasons: ל + עשׂות = לעשׂות is the infinitive עשׂות prefixed by the preposition ל which means "for" or "to" and expresses purpose. The preposition ל is not the preposition ו "waw" meaning "and" as it is translated in the KJV. The margin note indicates the KJV translators were aware that the Hebrew differed and was important to note. Only in Genesis 2:3 does the KJV translate לעשׂות "and made." Elsewhere the KJV translates the לעשׂות differently, examples being "to do" (91 times) and "to make" (21 times).
Conclusion from (2):The writer of Genesis considered the words "bara" and "asah" to be different as indicated by that writer's use of the two words. These words are not interchangeable in the creation account.
The First 23 Hebrew Words: How Long a Time?
It has been shown that the first two verses of Genesis are completed before the "And God said . . ." of Genesis 1:3. The time information given in Genesis 1:1 and Genesis 1:2 leads to a different creation model than that advocated by those holding to a "Young Earth" view. The table below lays out the differences for comparison.
[th]Hebrew Time Sequence of Genesis 1:1-3 [/th]
[th]"Young Earth" Time Sequence of Genesis 1:1-3 [/th]

Creation of the heavens and the Earth as in Genesis 1:1 Not instantaneous

 Time interval

Condition of planet Earth, Genesis 1:2

 Time interval



- - - Start of first creative time - - -
 "And God said . . ."

- - Start of first creative time - -
Instantaneous creation of the universe and planet Earth as in Genesis 1:2
"And God said . . ."



The "Young Earth" interpretation is that advocated by Henry Morris. Morris considers the events of Genesis 1:1 to instantaneously take place as the first act of the events of the first creative time. His interpretation was intended to explain the fossils as a result of the flood of Noah. The time intervals between Genesis 1:1 and Genesis 1:2, and between Genesis 1:2 and Genesis 1:3 represent a difficulty for that model.
Those who wrote in The Fundamentals in the early 1900s accepted an old universe and an old planet Earth.2 They accepted the old universe and the time intervals as being consistent with the text of Genesis 1:1-3. Those holding to a "day-age" meaning of the concluding phrases (a commonly held view) placed the fossils within the long time spans of the creative time periods. Those holding to a 24-hour interpretation of the concluding phrases placed the fossils in geologic ages within the time intervals between the verses.
The 1909 and the 1917 Scofield Reference Bibles contained a footnote for Genesis 1:1 which read in part, "The first creative act refers to the dateless past, and gives scope for all the geologic ages." In this case the geologic ages were placed between Genesis 1:1 and Genesis 1:2. The interval between Genesis 1:2 and Genesis 1:3 had been noted and commented on by G. V. Wigram, in about 1877. Wigram had also noted and commented on the unusual position of the Hebrew verb in the first two verses. Wigram favored placing the "geologic ages" between Genesis 1:2 and Genesis 1:3.3
Not Instantaneous: For Genesis 1:1 to be contained within an assumed 24-hour first creative time period, the word translated "In the beginning" must be taken as representing an extremely short period of time. The planet Earth and the universe are assumed to appear in less than a 12-hour "daytime." This assumption of an instantaneous appearance of planet Earth and the universe is not supported by the actual uses of the Hebrew word "beginning" in the Bible.
What is the "beginning"? The word ראשׁית "beginning" in the Hebrew does not refer to something which happens in an instant, like a bolt of lightning. "Beginning" refers to events which take place over a longer time period of unstated length. It is in this sense that the English word "beginning" is to be understood. In English, the word "prologue" would be an apt translation of the word "beginning" as used in Genesis 1:1. Consider the word בראשׁית translated "in the beginning" used in Jeremiah 28:1.
KJV Jeremiah 28:1And it came to pass the same year, בראשׁית in the beginning of the reign of Zedekiah king of Judah, in the fourth year, and in the fifth month, that Hananiah the son of Azur the prophet, which was of Gibeon, spake unto me in the house of the LORD . . .
The events take place four years after Zedekiah starts to rule. The NIV translation recognizes this and translates בראשׁית as ". . .early in the reign of . . .."
The word ראשׁית "beginning" is also used in Genesis 10:10 and refers to the kingdom of Nimrod. The KJV translation of this verse reads:
KJV Genesis 10:10And the ראשׁית "beginning" of his kingdom was Babel, and Erech, and Accad, and Calneh, in the land of Shinar.
Clearly the "beginning" refers to a considerable amount of time—time enough to build, or come to rule, four cities. The four cities are said to be the "beginning" of the kingdom of Nimrod. That kingdom amounted to many more cities than the mentioned four. The Bible does not state the length of the life of Nimrod. The lives of those who could be contemporary with Nimrod range from 250 to 450 years. This implies that the "beginning of his kingdom" could easily refer to a time span of 50 to 100 years, or more.
Conclusions:
 "In the beginning" represents a long period of time and Genesis 1:1 represents a long period of time. Genesis 1:1 through Genesis 1:2 represents a long period of time. All precede the "And God said" of Genesis 1:3.

The Six "Yom": Times or Days? Why the Fuss?
Times (ages), or days, for all views, the first 23 Hebrew words of the Bible are consistent with an old universe and an old planet Earth. This was known in the early 1900s. Now science has grudgingly verified the first testable truth statement of the Bible. The scientific evidence for a beginning is powerful. That beginning, and the evidences for fine tuning and design, has placed the existence of God back on the table in an agnostic world.
Times (ages), or days, either view does not conflict with the existence of an old universe or an old planet Earth before the start of the first creative time period.
The writers of The Fundamentals held both views as to the meaning of "yom" with respect to the six creative times. Why do "Young Earth" advocates insist that planet Earth is only about 10,000 years old?
Why the fuss? The issue was fossils!
It was thought that if Darwinism was to be opposed, the fossils needed to be explained. The fossils and Darwinian evolution invoked vast ages of time as a basic postulate. The implicit assumption was that, given enough time, Darwinian evolution could explain the origin of life. It was, therefore, believed that Darwinian evolution could be effectively opposed by claiming that planet Earth was created no more than about 6,000 to 10,000 years ago.
As scientific evidence of the complexity of life has been discovered, billions of years are insufficient for Darwinian explanations of the origin of life.
The foregoing discussion in this article has documented biblical objections to the instantaneous creation of planet Earth about 6,000 to 10,000 years ago. Science now views the appearance of the universe as instantaneous, but not 10,000 years ago, and not with the appearance of age, and not in its present state.
The assertion that Darwinian evolution cannot be true because planet Earth is only 10,000 years old (something the Bible does not say) does not convince the unbelieving agnostic. Such a claim does question the truth claims of the Bible. One cannot defend the truth of the Bible by asserting that which the Bible does not say.
What does this Mean for Models of the Creative Times?
If 24-hour days are assumed, does the "Young Earth" automatically result?
NO! The "Young Earth" requires more than 24-hour days. It requires immediate fulfillment of the creative commands and six immediately consecutive יום "days." The Hebrew text contains indications not consistent with those assumptions. 24-hour creative days of command can lead to a long time interval between Genesis 1:3 and Genesis 1:31.
If 24-hour days do not automatically yield a "Young Earth," why the claim?
The rise of the "Young Earth" view to its present prominence began with the 1961 publication of the Genesis Flood, one of whose authors (Henry Morris) was a Professor of Hydrology.
The issue was to deny Darwinism by explaining the fossils as a result of the flood of Noah. The creation of the animals and Adam are viewed as very recent. Any interpretation that allowed for an old earth, old fossils, or a local, non-universal flood would not work. Since the instantaneous creation of plants required soil, this also required instantaneous creation of soil with the appearance of age. Functionally, the doctrine of creation with the appearance of age allowed denying any physical evidence indicating an old age for the universe or for planet Earth. Morris did allow that the genealogies could not be used to determine the time of the flood or of Adam.
That the genealogies could not be so used to determine the time of the flood or the creation of Adam had been known since 1890. This had been established by the publication of Primeval Chronology, in 1890, by Dr. William Henry Green, Professor of Old Testament at the Princeton Theological Seminary. Benjamin B. Warfield, also a professor at the Princeton Theological Seminary, wrote the article, "The Deity of Christ" in The Fundamentals . He held an Old Earth view and opposed Darwinism. Warfield stressed the biblical doctrine of the unity of the human race, a fact with which modern DNA analysis concurs. In the 1911 Princeton Theological Review he wrote, concerning "Young Earth" interpretation of Genesis: "The Bible does not assign a brief span to human history: this is done only by a particular mode of interpreting the biblical data, which is found on examination to rest on no solid basis."4
Next we will examine Hebrew text that calls into question the "Young Earth" assumptions of immediate completion of the creative commands and the assumption that the creative times are immediately consecutive. Many readers will not be aware that 24-hour creative days do not require a "Young Earth" model.
When are the Commands Fulfilled? What does the Text Say?
The Hebrew consonantal phrase ויהי כן appears nine times in the Bible, six of which are in Genesis One. In Genesis this phrase is used to describe the completion of commands. In Genesis One, the KJV translates ויהי כן as "and it was so." The verb ויהי is translated by the KJV "and it came to pass" 320 times. The following word כן, is the word usually translated "so." This phrase does not mean that the "
« Last Edit: November 09, 2017, 03:04:58 PM by DunkingDan »
President Harry S. Truman said: “The fundamental basis of this nation’s laws was given to Moses on the Mount.  The fundamental basis of our Bill of Rights comes from the teachings…  If we don't have the proper fundamental moral background, we will finally wind up with a totalitarian government which does not believe in rights for anybody except the state.”

DunkingDan

  • Global Moderator
  • Hall of Fame
  • *****
  • Posts: 18289
  • Liked:
Re: Militant Atheist?
« Reply #147 on: November 09, 2017, 03:00:10 PM »
DD, thanks.  I read every word.  Interesting.
Thanks I am glad you enjoyed it. I wish I could have pasted the references but they would not come across
President Harry S. Truman said: “The fundamental basis of this nation’s laws was given to Moses on the Mount.  The fundamental basis of our Bill of Rights comes from the teachings…  If we don't have the proper fundamental moral background, we will finally wind up with a totalitarian government which does not believe in rights for anybody except the state.”

DunkingDan

  • Global Moderator
  • Hall of Fame
  • *****
  • Posts: 18289
  • Liked:
Food for thought pt 2
« Reply #148 on: November 09, 2017, 03:05:44 PM »
the "so" was achieved immediately. The meaning of the phrase ויהי כן can be determined from the three verses, not in Genesis One, which also use the phrase. 2 Kings 15:12 will be considered here as an example.

KJV 2 Kings 15:12This was the word of the LORD which he spake unto Jehu, saying, Thy sons shall sit on the throne of Israel unto the fourth generation. ויהי כן And so it came to pass.

The events that the words ויהי כן describe in 2 Kings 15:12 do not take place immediately. They take place over an extended period of time, four generations. The Hebrew verb does indicate a completed action, but "when" the action is completed is not indicated by the ויהי כן phrase. The other verses are discussed in the book Reading Genesis One.
Consequences for the translational issues and time models
Because ויהי כן does not indicate immediate command completion, it supports and fits well with the view that the creative times are long periods of time. These long periods of time allow for the later completion of the commands.
For an assumed 24-hour day, because the completion of the commands does not take place immediately within the daytime, a time interval is indicated. This leads naturally to a model where the 24-hour creative "days" are separated by long periods of time. The completion of the commands takes place within a long time interval between the creative "days" of command, between the "morning" and the following "and God said."
This author does not advocate any 24-hour model. This author considers the creative times to be long periods of time. The foregoing discussion was intended to present information illustrating additional textual problems of the 24-hour model commonly being advocated.
Are there Time Intervals between the Creative "Yom"?
In Hebrew narrative, the time interval between the actions in successive sentences is often not specified. This is an important factor to consider when studying Genesis 1:1-31. Often unnoticed, the time interval between the ". . . and there was evening and there was morning, one time" of Genesis 1:5 and the following "And God said . . ." of Genesis 1:6 is not stated and is not determinable from the Hebrew text. This time interval cannot be assumed to be zero just because it is not stated.
The existence of such intervals is verified by the example of Genesis 28:10-11 which demonstrates that such intervals cannot be assumed to not exist on the basis of not being stated. Genesis 28:10-11 is about Jacob departing Beersheba to seek a wife from among his relations in Haran.
KJV Genesis 28:10And Jacob went out from Beersheba, and went toward Haran.
 
 A time interval of unstated length
 
KJV Genesis 28:11And he lighted upon a certain place, and tarried there all night, because the sun was set; and he took of the stones of that place, and put them for his pillows, and lay down in that place to sleep.
It is only later in Genesis 28:19, where the place is identified as Bethel, that the time interval can be estimated. Beersheba to Bethel is a distance of about 60 miles as the crow flies. This distance, given the terrain and travel conditions of the time, would represent a journey of about four days. This estimate is based on the similar journey made by Abraham for the offering of Isaac (Genesis 22:1-19).
For those who wish to interpret the creative "yom" as 24 hours, the time intervals between the six creative time periods are factors that cannot be ignored.
It is important to note that the existence of time intervals between the six creative time periods does not impair the long time (day-age) view or all possible 24-hour day models. It does conflict with the typical "Young Earth" 24-hour day model, where these time intervals have been assumed away without textual evidence.
Key Issue 5:
What about יום "Yom"? What does יום "Yom" Mean?
1. The most frequent meaning of יום "yom" is daytime. Upon reflection, this conclusion is to be expected and is not surprising. The Bible most often uses יום "yom" when referring to events which take place in the daytime. Consider the example below using היום "the yom."
KJV Genesis 18:1And the LORD appeared unto him (i.e., Abraham) in the plains of Mamre: and he sat in the tent door in the heat of the day;
 (היום "the yom" is translated "the day.")
Exodus 34:28, shown below, presents another use. The word יום "yom" is in the singular, meaning "daytime," but in the KJV יום "yom" becomes "days." The Hebrew word for night is similarly singular, not the translated "nights." Exodus 34:28 shows that the singular word יום "yom" did not include the night. "Yom" replaces the KJV "days" in the verse below.
KJV Exodus 34:28So he was there with the LORD forty "yom" and forty nights . . . .
לילהוארבעיםיוםארבעיםיהוהעםשׁםויהיExodus 34:28
nightand fortyyomfortyYahweh (KJV "the LORD")withthereand he had been
Another reference to "forty days and forty nights" occurs in Deuteronomy 9:25 using היום "the yom." There היום "the yom" replaces the KJV "days" in the verse as shown below.
KJV Deu. 9:25Thus I fell down before the LORD forty היום "the yom" and forty nights as I fell down at the first; because the LORD had said he would destroy you.
In Deuteronomy 9:25 both day and night are mentioned. Here היום "the yom" refers to the time of illumination from the sun, about 12 hours. It does not mean 24 hours. If "the yom" included the night it would not be necessary to mention the night explicitly.
Numbers 3:1 refers to the events of Exodus 34:28. Here ביום "in the day" includes the entire 40 daytimes and 40 nighttimes, and means a long period of time.
KJV Numbers 3:1These also are the generations of Aaron and Moses ביום in the day that the LORD spake with Moses in Mount Sinai.
The meaning of ביום "in yom" does not depend on the prefix ב "in." For example, consider Abraham's journey to sacrifice Isaac, where ביום refers to the "daytime."
KJV Gen. 22:4Then ביום on the third day Abraham lifted up his eyes, and saw the place afar off.
2. The second most frequent use of יום "yom" is to refer to long periods of time. Consider Isaiah 23:15 which equated ביום ההוא "in yom that" with seventy years:
KJV Isaiah 23:15And it shall come to pass ביום ההוא in that day, that Tyre shall be forgotten seventy years, according to the days of one king: after the end of seventy years shall Tyre sing as an harlot.
Another example is the well-known messianic passage, Isaiah 11:10 shown below:

KJV Isaiah 11:10 And ביום ההוא in that day there shall be a root of Jesse, which shall stand for an ensign of the people; to it shall the Gentiles seek: and his rest shall be glorious.

The translation "time" is consistent with יום "yom" as used to express long time periods in:
  • יום יהוה "day of the Lord," and similar expressions.
  • ביום ההוא "in that day" (used more than 100 times referring to long periods of time).
  • עד היום "until this time" (KJV "unto this day," used more than 82 times).
3. The use of יום "yom" to refer to 24 hours is infrequent. Such use is usually in reference to the sabbath or festivals and ceremonies which include a remembrance of the Exodus. As a remembrance observance, the daytime of the sabbath represents the daytime departure of the Exodus. The night preceding the sabbath daytime corresponds to the night of the Passover. This use is illustrated in the definition of the Day of Atonement, "Yom Kippur," commanded in Leviticus 23:27 and defined as a sabbath in Leviticus 23:32. The meaning of יום "yom" is best understood by not reading the italicized words added by the KJV, which do not appear in the Hebrew.
KJV Lev. 23:27Also on the tenth day of this seventh month there shall be יום a day of atonement:
KJV Lev. 23:32It shall be unto you a sabbath of rest, and ye shall afflict your souls: in the ninth day of the month at even, from even unto even, shall ye celebrate your sabbath.
This author's longer study, Reading Genesis One, contains an extensive analysis of the Hebrew word יום "yom." That study determined that יום "yom," as used in Genesis 1:5, is correctly translatable by the English word "time" and that the 24-hour day meaning is unlikely. Readers who wish to understand more about the Hebrew word יום "yom" should consult that book. The table of contents is available at www.creationingenesis.com
Six Times or Six Days? What are the Issues?
The six creative times of Genesis One all end in a patterned phrase. The Hebrew for that phrase, as used in Genesis 1:5, is shown below using the typical English translation for the verbs. The verb is a completed action in the Hebrew, which indicates that the "evening" had occurred or "had been," and subsequently the morning had occurred. The time between these evenings and mornings is not said and is unknown.
      Genesis 1:5 line (2)
אחדיוםבקרויהיערבויהי
onetimemorning"and there was" evening"and there was"NAS, NIV, and RSV
The יום "yom" is translated "time" in agreement with the known frequent use as meaning a long period of time. Time is preferred and avoids the confusing use of the English word "day" with two different meanings. Four verses use יום "yom" in its most frequent meaning of "daytime." These uses will now be discussed.
Four uses of the word יום "yom" to mean "daytime"
Excluding the six concluding phrases, Genesis 1:1-31 uses the singular יום "yom" (or a singular form of "yom") four times and a prefixed form of the plural ימים "yoms" one time.
KJV Genesis 1:5And God called the light יום "yom," and the darkness He called night.
KJV Genesis 1:14Then God said, "Let there be lights in the expanse of the heavens to separate היום "the yom" from the night, and let them be for signs, and for seasons, ולימים and for "yoms," and years:
KJV Genesis 1:16And God had made the two great lights, the greater light to govern היום "the yom" and the lesser light to govern the night; . . .."
KJV Genesis 1:18And to rule ביום over the "yom" and over the night, and to divide the light from the darkness: (Here the KJV translates ביום "in yom" as "over the day.")
The three singular forms used in these verses all refer to the time of illumination by the sun, the daytime. Because the meaning is the same in all verses, these verses show that prefixing by ב "in" or by ה "the" does not determine the meaning of יום "yom." The Hebrew word יום "yom" appears alone and in prefixed forms. It appears as יום 241 times in the Bible. יום "yom" is used with prefixes more than another 1,000 times.
The next use of יום "yom" is ביום in Genesis 2:4.
KJV Genesis 2:4These are the generations of the heavens and of the earth when they were created, ביום in the day that the LORD God made the earth and the heavens,
Here ביום "in yom" refers to all the preceding six "yom," a long period of time, not 24 hours, and does so refer, no matter what English word is used in the translation.
The numbering of the creative "yom"
The numbering pattern of "yom one," and subsequently יום שׁלישׁי ,יום שׁני, etc., is used only in Genesis One. In other numberings of the word יום "yom," biblical Hebrew almost always does two things which are not done in the numbering of the creative "yom." It prefixes each number by ה (the prefix meaning "the") and attaches a prefix to the word יום "yom." In Genesis One, the first five creative "yom" are numbered without prefixing ה to the numbers. For example, Genesis 1:8 uses שׁני and not השׁני "the second" as used in other numberings. The KJV translation added "the" to all the numbers of the first five "yom" but did not italicize "the," making the absence of ה not apparent to the reader. Similarly, the absence of a prefix, as used with יום "yom" when numbered elsewhere in the Bible, is not apparent to a reader of English translation. Consequently, some will now claim that the phrases having יום "yom" followed by a number must be 24-hour days, not knowing that the words translated "the second day" of Genesis 1:8 should properly be translated "a second day," and similarly for the first five "yom."5 As a result, arguments for 24-hour days based on claims referring to the numbering in other verses of the Bible are faulty. The pattern used to conclude the first five creative times is:
  • Evening occurs (a completed action), i.e., and there was evening.
  • Morning occurs (a completed action), i.e., and there was morning.
  • יום "yom" followed by a non-prefixed number ends the concluding phrase.
The use of יום "yom" with a following non-prefixed number for numbering a sequence is unique to Genesis 1:1-31. Contrary to some claims, there are no other applicable examples.
What does this mean for models of the creative times?
The evidence presented has shown that it is unlikely that the creative "yom" are 24-hour days.
If 24-hour days are assumed, does the "Young Earth" model automatically result?
NO! The advocates of the "Young Earth" model have based their model on more than 24-hour days. They claim immediate fulfillment of the creative commands and six immediately consecutive יום "days." The next section will examine these and other issues.
After the Creation: What Models of the Six Creative Time Periods are Consistent with the Hebrew?
The "Long Creative Times" model of the six creative time periods is, in this author's opinion, the preferred reading of the Hebrew text. However, there will be readers of this brief article who will still wish to consider possible 24-hour day type alternatives. Because of this, a comparison of possible models is presented in the following table and discussion.
Are any models which assume a 24-hour day possibly consistent with the Hebrew?
Yes. But such models differ from the 24-hour day model commonly advocated today. The table below illustrates features required of such models if they are to be consistent with the Hebrew text. Textual evidence for the time intervals immediately follows.
THE LONG CREATIVE TIMES MODEL
 ( The model preferred by this author)
THE 24-HOUR "CREATIVE DAY" MODEL AND TIME INTERVALS POSSIBLY CONSISTENT WITH THE HEBREW TEXT
The creation of the heavens and the Earth in Genesis 1:1, the time intervals, and Genesis 1:2. A long period of time, billions of years. The creation of the heavens and the Earth in Genesis 1:1, the time intervals, and Genesis 1:2. A long period of time, billions of years.
Creative Time One (a Long Time)
Command completion within the long creative time

 ↓
Creative "day" One (24-hours)
↑ Time
 ↓ Interval
Command completion between "days" of command
Creative Time Two Creative "day" Two (24-hours)
The above 24-hour day model differs from the usual "Young Earth" model. In the usual "Young Earth" model the time intervals have been assumed away. With their inclusion, one naturally obtains a 24-hour day model of "days of command" separated by intervals of time providing for command completion.
Is there Additional Evidence for long Time Periods?
Yes. The events described in Genesis 1:24-31 and Genesis 2:5-25 describe the activities of God, Adam, and Eve during the sixth creative "time." With "yom" translated "time" the events can be understood as occurring in an amount of time reflecting the usual meanings of the words. It is not necessary to "speed up" the performance rate of the events described in Genesis 1:24­ 31 and Genesis 2:5-25 .
In brief, the events during the sixth creative "time" include:
  • God commands and the ground brings forth cattle.
  • God creates ("bara") Adam.
  • God plants a garden.
  • Trees grow to sufficient maturity to bear fruit.
     (This requires at least a growing season, but often many seasons may pass before fruit is borne.)
  • Adam is given permission to eat from most of the trees.
  • Adam names the animals which are brought to him.
  • Adam sleeps and God removes tissue (KJV "rib") from Adam's side.
  • Eve is formed (cloned?) from the tissue (KJV "rib") and brought to Adam.
All the above suggest the passage of a considerable period of time. These are not the events of one daytime! The time of the growing season for the production of fruit is at least several months. This sense of time is contained in the ordinary meaning of the words and applies to all the actions, conveying a sense of the passage of considerable time. Genesis 2:15 indicates that Adam had performed gardening duties of some sort for a considerable period of time.
KJV Genesis 2:15And the LORD God took the man, and put him into the garden of Eden to dress it and to keep it.
Those advocating a 24-hour creative time period often assert that the time between Genesis 1:3 and Genesis 1:31 is 144 hours (6 days x 24 hours). Because of this, they are forced into the absurd position of requiring all of the above events to take place at "warp speed." Everything listed above for creative "yom" six would take place in about 12 hours! This would also be required for the events of the other creative "yom." There is no indication in the biblical Hebrew of these sections that the events were accomplished at an unusual rate. The translation time in the concluding phrases allows these sections to be understood more normally, consistent with the manner in which they were written.

Recall: The age of planet Earth and the age of the universe are not determined by the time length attributed to the six creative times.

Summary: This brief study of Genesis One has shown that:
Genesis 1:1 describes already completed background information. Genesis 1:1 presents the creation of the universe and planet Earth as an already completed fact, albeit that the Earth is not in the final condition which we observe today.
"In the beginning" represents a long period of time and Genesis 1:1 represents a long period of time. Genesis 1:1 through Genesis 1:2 represents a long period of time.
Genesis 1:2 also describes already completed background information. The "And the Earth" in Genesis 1:2 indicates that some time has elapsed since the creation of "the heavens and the Earth" in Genesis 1:1.
The command "And God said . . ." of Genesis 1:3 starts the first creative "yom." Genesis 1:1 and Genesis 1:2 are completed before the start of the first creative time period. There is also a time interval of unstated and unknown length between Genesis 1:2 and Genesis 1:3.
The significance of the time intervals is that the Bible makes no statement about the age of the universe or the age of planet Earth. As a consequence, the biblical text is consistent with an old universe and an old Earth, both billions of years old. This result is found for any view of the time length of the creative "yom".
The Bible does make a statement about a beginning to the universe, a fact which science has grudgingly now accepted, thereby attesting to the truth of the first testable truth statement of the Bible.
Things Genesis One Does and Does Not Say (a partial list):
  • Genesis One does say that there was a beginning to the universe and planet Earth.
  • Genesis One does say that God created the heavens and the Earth.
  • Genesis One does say that planet Earth was not always as it is now; changes have occurred.
  • Genesis One does say that God acted to bring the present condition of the Earth into being.
  • Genesis One does not specify an age for the Earth or an age for the universe.
  • Genesis One does not say that the creative times (yom) are 24 hours in duration.
  • Genesis One does not say that the creative times (yom) followed immediately one after another.
  • Genesis One does not say that the commands were fulfilled immediately, like a bolt of lightning.
These conclusions are not new. They were well known in the early 1900s. At the present time there is among evangelical Christians a degree of confusion about Genesis One. The confusion has arisen from the advocacy of a "Young Earth" reading of Genesis One. This advocacy has come to prominence mainly within the past 40 years. It is the opinion of this author that this rise to prominence has been aided by the Darwinists themselves. The opposition to Darwinism by the "Young Earth" advocates serves the Darwinists because it avoids the need to mount a scientific defense of Darwinism. Instead, the Darwinist can attack the claims and assertions of the "Young Earth" advocates, assertions which are not in accord with the Hebrew of Genesis One. The Bible cannot be effectively defended nor can the Gospel be effectively proclaimed by asserting things which the Bible does not say.
This confusion has now reached the point where some people think that those who wrote in The Fundamentals were "Young Earth" believers. Not so! They did not hold "Young Earth" views; they accepted an Old Earth view. With respect to Darwinism, they did not view the Old Earth as the issue; they recognized that the essence of Darwinism was a denial of design and thereby a denial of a creator God.
Four of the writers of The Fundamentals, C. I. Scofield, Benjamin B. Warfield, James Orr, and R. A. Torrey (a noted evangelist) were well known for their acceptance of an Old Earth. These writers and others opposed Darwinism on the basis of theology and presented arguments citing evidence of design. Today it is the implicit evidence of design in the complex structure of life that is the basis of a very effective opposition to Darwinism. These arguments speak to the scientific evidence. Argument from design has confronted advocates of Darwinism with scientific evidence which does not support the claims of Darwinism.
Books like Darwin's Black Box6 and Darwin On Trial7 have altered the terms of the confrontation with Darwinism.
The message of Genesis One is primarily theological. It informs the descendants of Adam (mankind) about their origin and about their relationship to their Creator. The message is that God is the Creator of Adam (mankind) and that mankind has a responsibility toward God and is accountable to God. The modern attacks on Genesis One have, as their basis, a wish to discredit this theological message and to assert freedom from accountability.
Theological Content
Some of the theological content of Genesis One escapes our attention today because the sun and moon are not presently viewed as gods. At the time of Moses, Genesis One expressed powerful theological contradictions to the religions of Egypt, Canaan, and Babylon. Some of these contradictions are:
  • One creator God, not many gods.
  • The sun and moon are created objects, not gods.
  • The animals are created and are not gods.
The Egyptians worshiped many creatures. Because the theological message that the sun and moon are not gods is not significant in our time, it is possible to mistake Genesis One as being a description of the physical and biological history of planet Earth. Genesis One does make statements about the physical and biological development, but does so as a subsidiary to the theological message against the pagan gods worshiped at the time of Moses. The statements are true, but the statements are an incomplete description of the events that transpired.
At the present time, the opposition to the theological message of Genesis One is opposition to a Creator God who acts in history and in time. The tactic is to interpret the "when" and the creative acts in a way that introduces conflict between the interpretation and the observable geological record. The Darwinist typically assumes a God that does not act in history or geologic time, or assumes there is no God at all. The Bible reveals a God who does act in history and in geologic time.

END NOTES:

President Harry S. Truman said: “The fundamental basis of this nation’s laws was given to Moses on the Mount.  The fundamental basis of our Bill of Rights comes from the teachings…  If we don't have the proper fundamental moral background, we will finally wind up with a totalitarian government which does not believe in rights for anybody except the state.”

DunkingDan

  • Global Moderator
  • Hall of Fame
  • *****
  • Posts: 18289
  • Liked:
Re: Militant Atheist?
« Reply #149 on: November 09, 2017, 03:09:46 PM »
fuzzy wrote: "Man IS an ape.  Take a look in the mirror - both halves are ape (and man)."  

The current theory of human evolution states that modern humans evolved from more primitive A form of walking characterized by an erect stance in which the rear legs are utilized for movement.bipedal Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominids. The first A form of walking characterized by an erect stance in which the rear legs are utilized for movement.bipedal A member of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominid The second smallest classification name given for each biological species. Each genu can be comprised of one or more species.genus that is supposedly the ancestor of modern humans is A genus of extinct hominids, characterized by being the earliest bipedal primate (up to 3.7 million years ago).Australopithecus, which appeared in the fossil record from about 4.4 to 1 million years ago throughout eastern Africa. A genus of extinct hominids, characterized by being the earliest bipedal primate (up to 3.7 million years ago).Australopithecus comprised a diverse group of small-brained A form of walking characterized by an erect stance in which the rear legs are utilized for movement.bipedal species that were confined to the savannas of Africa. This The second smallest classification name given for each biological species. Each genu can be comprised of one or more species.genus was supposed to have evolved into the The second smallest classification name given for each biological species. Each genu can be comprised of one or more species.genus A genus within the subfamily Homininae that includes modern humans and related species (e.g., Homo habilis, Homo erectus, Homo ergaster, and Homo sapiens)., which has been defined as A form of walking characterized by an erect stance in which the rear legs are utilized for movement.bipedal An order of mammals including man, apes, monkeys, etc., often characterized by large brains and flexible hands and feet.primates with a brain capacity over 700 cc, having appeared in the fossil record by about 2.5 million years ago as An extinct species of the genus Homo, which lived approximately 2.5 million to 1.6 million years ago. in eastern Africa. According to theory, An extinct species of the genus Homo, which lived approximately 2.5 million to 1.6 million years ago.Homo habilis evolved into An extinct species of the genus Homo, which appeared approximately 1.8 million years ago.Homo erectus, which had a brain capacity just over 1000 cc, appearing in the fossil record from about 1.8 million to 300 thousand years ago. An extinct species of the genus Homo, also known as Neanderthal (or Neandertal) man, which appeared approximately 400,000 years ago. lived between 400 and 28 thousand years ago. Archaic The only surviving hominid species, comprising modern human beings and characterized as being a bipedal primate with a large brain capacity, capable of language and the ability to make and use complex tools. appeared 400 - 150 thousand years ago, and modern The only surviving hominid species, comprising modern human beings and characterized as being a bipedal primate with a large brain capacity, capable of language and the ability to make and use complex tools. from less than 100 thousand years ago. Contrary to the claims of many creationists, there is ample evidence for the existence of human-like species of A form of walking characterized by an erect stance in which the rear legs are utilized for movement.bipedal An order of mammals including man, apes, monkeys, etc., often characterized by large brains and flexible hands and feet.primates. The dates and ages of these fossils are not widely disputed in scientific circles. The reality of the fossil record and the reliability of the dates of these fossils is actually instrumental in disproving the descent of man theory. If the fossil record were not as complete as it now is, the standard evolutionist argument would apply, "we just haven't found the missing link ancestor of modern humans yet."
The beginning of trouble - lack of genetic diversity among modern humans
As evolutionists studied humans and species of apes in the 1970's and 1980's, some rather surprising information was being discovered that distinguished us from apes and other An order of mammals including man, apes, monkeys, etc., often characterized by large brains and flexible hands and feet.primates. The maximum A calculated proportion of total genetic variability attributable to the genetic differences between populations.Fst value (a measure of variation between population groups) between human races is 0.08 (1, 2). However, among populations of Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.chimpanzees, orangutans, and other An order of mammals including man, apes, monkeys, etc., often characterized by large brains and flexible hands and feet.primate species, A calculated proportion of total genetic variability attributable to the genetic differences between populations.Fst values are commonly more than 0.20. An examination of 62 common An organic compound made of amino acids arranged in a linear chain, joined together by peptide bonds between the carboxyl and amino groups of the adjacent amino acid residues.protein coding genetic Multiple places on a chromosome where specific genes or genetic markers are located, a kind of address for the gene.loci, indicates a Replacement of one nucleotide in a DNA sequence by another nucleotide or replacement of one amino acid in a protein by another amino acid.substitution rate of 0.011/The place on a chromosome where a specific gene is located, a kind of address for the gene.locus (A member of the racial classification of humanity composed of peoples native to Europe, North Africa, Southwest Asia and parts of South Asia.Caucasoids versus Members of the racial classification of humanity composed of peoples native to North Asia, East Asia, Pacific Oceania, the Americas and Greenland.Mongoloids), to a maximum of 0.029 (Members of the racial classification of humanity composed of peoples native to North Asia, East Asia, Pacific Oceania, the Americas and Greenland.Mongoloids versus Members of the racial classification of humanity composed of peoples native to sub-Saharan Africa.Negroids). However, in nearly all other animal species studied, including apes, usually exceed 0.05 (2). In humans, Possessing two different forms (alleles) of a particular gene, one inherited from each parent.heterozygosity (the proportion of Variant forms of a gene at a particular locus, or location, on a chromosome.alleles that are Consisting of a common variation in the sequence of DNA among individuals of a species or race.polymorphic, in this case within the species) is 1.8% , whereas in apes it ranges from 2.5 in the An arboreal great ape belonging to the genus Pongo, consisting of two species, Pongo pygmaeus of Borneo and Pongo abelii, characterized by a reddish-brown coat, very long arms, and no tail.Orangutan to 3.9 in the Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.Chimpanzee (3). An analysis of the genetics of populations of apes reveals that different population groups possess fixed novel Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations that characterize each population. In contrast, there are no novel Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations or genetic Variant forms of a gene at a particular locus, or location, on a chromosome.alleles that specifically characterize any one human race from another. More recent studies have confirmed the early work, likewise showing that human genetic diversity is far less than what one would predict from Darwinian theory. Dr. Maryellen Ruvolo (Harvard University) has noted, "It's a mystery none of us can explain." (4). Examinations of the genetic The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of diverse modern human populations reveals minor, if any differences (5). All of this evidence suggested a recent origin for modern humans.
Still more trouble - Discontinuous morphological changes in the A member of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominid lineage
Relating to the earth science study of fossil organisms and their related remains.Paleontological discoveries and The science of determining the absolute age of rocks, fossils, and sediments.geochronology show that the pattern of morphological change in the A member of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominid fossil record was not progressive, but abrupt (6). Some adaptations essential to The ability of a species to utilize a form of walking characterized by an erect stance in which the rear legs are used for movement.bipedalism appeared early, but others appeared much later. Although the 3.2 million year old fossil "Lucy" (A species of extinct hominid, living 3.9-2.9 million years ago, made famous by the skeleton "Lucy."Australopithecus aferensis), was said to be A form of walking characterized by an erect stance in which the rear legs are utilized for movement.bipedal, her 2.6 million year old descendent, A species of extinct hominid, living 3-2 million years ago, made famous by the skeletons "Taung Child" and "Mrs. Ples."Australopithecus africanus, was indisputably Living in or spending the majority of its' time in trees.arboreal (7). Primitive Comprising the cranium (braincase) and the teeth.craniodental complexes (similar to the reconstructed last common ancestor with the African great apes) were found in nearly all species of A family of the primate order, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.Hominidae (8). Relative brain size increased slightly among successively younger species of Referring to members of a genus of extinct hominids, characterized by being the earliest bipedal primate (up to 3.7 million years ago).Australopithecines, although many Referring to members of a genus of extinct hominids, characterized by being the earliest bipedal primate (up to 3.7 million years ago).Australopithecine skulls have brain capacities no larger than those of Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.chimpanzees. (9, 10). However, brain capacities expanded abruptly with the appearance of A genus within the subfamily Homininae that includes modern humans and related species (e.g., Homo habilis, Homo erectus, Homo ergaster, and Homo sapiens)., but within early A genus within the subfamily Homininae that includes modern humans and related species (e.g., Homo habilis, Homo erectus, Homo ergaster, and Homo sapiens). remained at about half the size of The only surviving hominid species, comprising modern human beings and characterized as being a bipedal primate with a large brain capacity, capable of language and the ability to make and use complex tools.Homo sapiens for almost a million years. The fossil record indicates an accumulation of relatively rapid shifts in successive species, and certainly not any kind of gradualistic changes.
Another problem - too many Having a harmful of bad effect.deleterious Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations
A recent study examined the A permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutation rate for humans. Using "conservative assumptions" the authors found that the overall A permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutation rates was 4.2 Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations per person per generation, with a Having a harmful of bad effect.deleterious rate of 1.6 (11). When using more realistic assumptions the overall A permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutation rate for humans become 6.7 with a Having a harmful of bad effect.deleterious rate of 3.1. Such a high rate should have resulted in extinction of our species long ago. They stated in their conclusion:
Quote
"The Having a harmful of bad effect.deleterious A permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutation rate appears to be so high in humans and our close relatives that it is doubtful that such species, which have low reproductive rates, could survive if Relating to a permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutational effects on fitness were to combine in a multiplicative way."
The authors had to rely upon a rare association of Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations, termed synergistic The interaction between genes, in which the action of one gene is modified by one or several other genes, which are called modifier genes. The gene whose phenotype is expressed is said to be epistatic, while the phenotype altered or suppressed is said to be hypostatic.epistasis to explain why the numerous hypothesized Having a harmful of bad effect.deleterious Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations have not overwhelmed our All the DNA contained in an organism or a cell, which includes both the chromosomes within the nucleus and the DNA in mitochondria.genome. Instead of postulating the obvious (that the human All the DNA contained in an organism or a cell, which includes both the chromosomes within the nucleus and the DNA in mitochondria.genome is not as old as evolution would teach), evolutionists must rely upon the improbable to retain the evolutionary paradigm.
Recent origin of modern humans confirmed through The branch of science that studies the structure and activity of macromolecules essential to life (and especially related to their genetic role).molecular biology

Of or referring to the mitochondria, the organelles that generate energy for the cell.Mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA (Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA)
In the late 1980's and early 1990's a number of studies were done examining the Of or referring to the mitochondria, the organelles that generate energy for the cell.mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA ( Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA) of women all over the world. These studies, nicknamed the "Eve theory," suggested that the last common ancestor of modern man (actually women) appeared within the last 200,000 years (12-15), much more recently than previously thought. Refinements in the measurements lowered the original estimates to 135,000 years (15) and finally 100,000 years (16). Scientists chose to examine Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA because, being enclosed within the subcellular organelle called the The organelle that generates energy for the cell.mitochondrion, there is no genetic recombination (males make no contribution of Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA to the fetus). All Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA comes from our mothers and is passed down from mother to daughter, since only The organelles that generate energy for the cell.mitochondria from the egg are used to make up the fetus. By tracing the differences in Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA from peoples around the world, scientists have calculated the probable date of the last common ancestor of modern humans at 100,000 to 200,000 years ago.
One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y-chromosome analysis
In 1995, scientists have examined human origins from the perspective of male genetics (17, 18). Scientists have examined a gene (ZFY), which being on the One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosome, is passed down only from father to son. Thirty-eight men were chosen from all over the world (Africa, Asia, Australia, Europe, and Northern, Central, and South America). Scientists determined the actual genetic The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence in each man for this gene, which is 729 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs long. To their surprise, all men had identical genetic The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences (over 27,000 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs analyzed). Scientists have calculated the most probable date for the last common ancestor of modern man, given the The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence diversity from modern apes. Using two different models this date is either 270,000 or 27,000 years ago. However, both these models assume that the male population during this entire period of time consisted of only 7,500 individuals. The date estimates from these models would be significantly reduced if the male population were higher than 7,500, which is very likely. Two separate studies using similar techniques looked at larger pieces of the One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosome, which would reduce the uncertainty in the calculation of dates. One study examined a gene which was 2,600 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs and determined a last common ancestor date of 188,000 year ago (minimum of 51,000 and maximum of 411,000 years ago) (19). The other study used a very large piece of the One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosome (18,300 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs) and calculated a last common ancestor date of modern man of 43,000 years ago (minimum of 37,000 and maximum of 49,000 years ago) (16). This latter study also examined Of or referring to the mitochondria, the organelles that generate energy for the cell.mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA from women and determined an origination date of 90,000-120,000 years ago.
The non-random association of alleles at two or more genetic loci, in which combinations of alleles or genetic markers occur more or less frequently in a population than would be expected from a random formation of haplotypes from alleles based on their frequencies.Linkage disequilibrium analysis
A study published in 1996 (20) examined The association of genes and/or markers that lie near each other on a chromosome that tend to be inherited together.linkage The non-random association of alleles at two or more genetic loci, in which combinations of alleles or genetic markers occur more or less frequently in a population than would be expected from a random formation of haplotypes from alleles based on their frequencies.disequilibrium at the human CD4 The place on a chromosome where a specific gene is located, a kind of address for the gene.locus (a T-cell associated antigen) as a means to establish the date of modern human origins. This study determined a maximum origin date of 102,000 years ago based upon the assumption that the A family of approximately 300 bp repetitive sequences, found dispersed throughout the human genome.Alu (-) Variant forms of a gene at a particular locus, or location, on a chromosome.alleles arose 5 million years ago, or almost immediately after mankind's split from other An order of mammals including man, apes, monkeys, etc., often characterized by large brains and flexible hands and feet.primates. As they stated, "It is likely that the A family of approximately 300 bp repetitive sequences, found dispersed throughout the human genome.Alu deletion event occurred more recently, in which case our estimates for the date of founding of the non-African populations would also be more recent." Preliminary studies from Threadlike "packages" of genes and other DNA in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes. Humans have 23 pairs of chromosomes, 46 in all: 44 autosomes and two sex chromosomes. Each parent contributes one chromosome to each pair, so children get half of their chromosomes from their mothers and half from their fathers.chromosomes 19, 11 and 8 show similar results to that seen on One of the threadlike "packages" of genes and other DNA in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes. Humans have 23 pairs of chromosomes, 46 in all: 44 autosomes and two sex chromosomes. Each parent contributes one chromosome to each pair, so children get half of their chromosomes from their mothers and half from their fathers.chromosome 12 (the The place on a chromosome where a specific gene is located, a kind of address for the gene.locus of the CD4 gene) (21).
Using rare mutations to estimate population divergence times
A study published in 1998 examined population divergence time using rare Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations between populations to estimate divergence among three Mediterranean populations. The results indicated that Danish people (who are my ancestors) would have diverged from the other groups, at most, 4,500 to 15,000 years ago (22). This number does not necessarily help us establish a date for the appearance of modern humans, but it is likely that future studies in this area (this is one of the first published) may provide accurate numbers for the appearance of human populations in different areas of the world and a lower limit to the date of appearance of modern humans.
The nail in the coffin
Therefore, the most accurate date (see note below) for the origin of modern humans indicate that the last common ancestor to modern humans must have existed less than 50,000 years ago (16). Such a recent date left only one potential ancestor for modern humans, that is, An extinct species of the genus Homo, also known as Neanderthal (or Neandertal) man, which appeared approximately 400,000 years ago. (An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals), which lived between 400,000 and 28,000 years ago. Previous anatomical studies had cast doubt on the possibility of An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals being the ancestors of modern humans (23-27). These studies showed differences in Belonging to an extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal's brain case (23) and the presence of an internal nasal margin, a medial swelling of the lateral nasal wall, and a lack of an Being made of bone or referring to the calcification of tissue into bone.ossified roof over the Relating to or located near the organ that produces tears.lacrimal groove (24-25). None of these features are found in The only surviving hominid species, comprising modern human beings and characterized as being a bipedal primate with a large brain capacity, capable of language and the ability to make and use complex tools., and the last feature is not found in any other terrestrial mammal! A recent analysis of An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal hands has revealed that modern humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals differed markedly in the kind of grip they could use (26). An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals were limited to grips as one has when holding a stone or baseball. Such a grip would have been powerful (you wouldn't want to shake hands with a An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal), but not very dexterous. The anatomy of the Belonging to an extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal's hands would have prevented them from engaging in fine motor skills, such as carving and painting. Another study showed that An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals developed much more rapidly than modern humans (or even their own supposed ancestors) (27), further eroding their possible status as mankind's ancestors. In addition, An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals had a huge nasal cavity coupled with a brain size larger than our own. However, with their carnivorous lifestyle, it seems likely that much of their brain might have been devoted to the sense of smell, being the "dog" among the Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominids (28).
In brilliantly designed and executed independent studies, scientists have extracted Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA from four An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal skeletons; two from Neander Valley in Germany, another from the northern Caucasus near the Black Sea, and the fourth in Vindija Cave, Croatia, and laid to rest any question of whether An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals could have been our ancestors (29-32). The first study examined a 379 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pair An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA fragment and compared it with a Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence of 986 One of the structural components, or building blocks, of DNA and RNA. A nucleotide consists of a base plus a molecule of sugar and one of phosphate.nucleotide pairs from living humans of diverse ethnic backgrounds. The results (Table 1) showed an enormous 26 One of the structural components, or building blocks, of DNA and RNA. A nucleotide consists of a base plus a molecule of sugar and one of phosphate.nucleotide Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pair difference between the An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal and Human Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA (a 6.5% difference) (29). In this region of the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA, modern humans differ from one another in an average of eight Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs, and those differences were completely independent of the 26 observed for the An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal fossil. However, many of the The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence variations found in the An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals were shared in the Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.Chimpanzee. A 357 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pair The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence of Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA was examined from the second An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal fossil and was found to vary from modern human The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences at 23 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.bases (6.4%), nineteen of which were identical to those of the first An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal. The third An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal differed from modern humans by 26 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.bases, 23 of which matched the first An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal and 20 of which matched the second specimen. The fourth An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal differed from modern humans by 23 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.bases, 22 of which matched the first An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal, 20 of which matched the second specimen and 23 of which matched the third specimen. A summary of the findings of the two studies can be found in Table 1, below.
Table 1. The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.Sequence Differences* Between Modern Humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals
[th]Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Sample
 (Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.HVR1)
[/th]
[th]Sequence Number (Read Down)
 111111111111111111111111111111111
 666666666666666666666666666666666
 000011111111111112222222222233334
 378900112345568880233455667912571
 786378129984692399304468238910420
[/th]
Modern HumanAATTCCCCGACTGCAATTCACGCAC-CATCCTC
Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.Chimpanzee......T.ATT.....ACTGAAA....G....
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal #1GG.CTTTTATTC.T.CCCTGTAAGTATGCT.CT
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal #2 .C.....ATT.ATCCCCTGTAA.TATGCTTC
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal #3GG......ATTC.TCCCCTGTAAGTATGCT.C
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertal #4GG......ATTC.TCCCCTGTAA.TATGCT.C
* Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.HVR1
The analysis of the second sample was extremely important, since it was dated at 29,000 years ago - only 1000 years before the last An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal disappeared (33). If An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals and humans had interbred, one should have expected to see this in the last remnants of the Belonging to an extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal's genetics. In addition, since the An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal fossils were separated geographically by over 2,500 km, it shows that An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals were a homogeneous species. The researchers conclusion: "An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals were not our ancestors" - a quote from the authors of the first study. In fact, the differences between modern humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals were so great that calculations indicated that the last common ancestor (according to evolutionary theory) must have existed 550,000 to 690,000 years ago (first study) and 365,000 to 853,000 years ago (second study).
Although the differences between modern humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals are large, the differences among individual humans or among individual An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals is small compared to other apes (Table 2). Such low genetic diversity among An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals are consistent with a creation model in which An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals were specially created as a small population in the relatively recent past. The much larger variation seen among Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.chimpanzees and gorillas does not eliminate them as specially created, but does place their probable creation date considerably before that of modern humans.
Table 2. Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.Sequence Variation (%) Within Species (31)
[th]Population[/th]
[th]Individuals[/th]
[th]Mean[/th]
[th]Minimum[/th]
[th]Maximum[/th]
[th]s.d.[/th]
An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals0,00303.73---
Humans5,53003.430.0010.161.21
Chimpanzees 0,35914.810.0029.065.70
Gorillas0,02818.570.4028.795.26
The final blow to the idea that humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals interbred was found in a genetic analysis of their Relating to one of the threadlike 'packages' of genes and other DNA in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes. Humans have 23 pairs of chromosomes, 46 in all: 44 autosomes and two sex chromosomes. Each parent contributes one chromosome to each pair, so children get half of their chromosomes from their mothers and half from their fathers.chromosomal Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA, published in 2006-2007 (34). These results showed that none of the typical SNPs found in modern humans was present in An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y-chromosome Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA.
Ancient Anatomically Modern Humans - the missing evidence
Knowing the variation of The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences between modern humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals is important in determining if An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals contributed to the human gene pool. However, without a measure of the variation among ancient anatomically modern humans and between them and modern humans, the data is incomplete. The first of these studies was published in 2001, examining the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of 10 ancient Australians (35). A summary of the Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.HVR1 The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence of these individuals (compared with the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, modern Aboriginal A common variation in the sequence of DNA among individuals of a species or race.polymorphism, An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals, and Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.chimpanzees) can be found in Table 3, below. The first thing that one notices is that the The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence variation of ancient humans compared to modern humans is at most 10 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs (in LM3, the most ancient specimen). As stated previously, the average variation among population groups of modern humans is 8 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs. LM3, dated at 40,000 years old (redated from the original estimate of 62,000 years old, 36), varied the most from the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, but this variation included only three Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.bases shared with An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthal specimens. Since LM3 was a contemporary (or lived even earlier than the An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals Determining the order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequenced to date), it is apparent that the human All the DNA contained in an organism or a cell, which includes both the chromosomes within the nucleus and the DNA in mitochondria.genome was already nearly "modern" before An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals died out. The authors of the study made a big deal about the LM3 The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence sharing similarity to a portion of One of the threadlike "packages" of genes and other DNA in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes. Humans have 23 pairs of chromosomes, 46 in all: 44 autosomes and two sex chromosomes. Each parent contributes one chromosome to each pair, so children get half of their chromosomes from their mothers and half from their fathers.chromosome 11 in modern humans (thought to have been inserted into the human All the DNA contained in an organism or a cell, which includes both the chromosomes within the nucleus and the DNA in mitochondria.genome from the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA). The authors concluded that the "loss" of the ancient Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA variation seen in LM3 could explain how An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals do not share Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA with modern humans. Although it is certainly possible that part of Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA might find its way into the nuclear All the DNA contained in an organism or a cell, which includes both the chromosomes within the nucleus and the DNA in mitochondria.genome, it doesn't address the issue of how the variation seen in the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA of LM3 was "lost." In fact, of the ten The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence differences between LM3 and the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, five of those Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.bases correspond to A common variation in the sequence of DNA among individuals of a species or race.polymorphisms found in modern Aboriginal people, showing that those five Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.bases were not lost at all. This leaves only a five Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base difference, certainly within the range of that found among modern humans. Overall, the lack of "evolution" for humans over the last 40,000 years stands in sharp contrast to the large differences seen between modern humans and An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neanderthals. European evolutionists have also disputed the claims of Adcock et al. in the journal Science in June, 2001. More information on this can be found in the paper, New DNA Evidence Supports Multiregional Evolutionary Model?
A second study examined the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of two Cro-Magnon specimens dated to 23,000 and 25,000 years old (37). One specimen (Paglicci-25) had no The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence differences from the modern reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, and the other (Paglicci-12) only one Replacement of one nucleotide in a DNA sequence by another nucleotide or replacement of one amino acid in a protein by another amino acid.substitution (see Table 3). It is remarkable that so little change in the The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence had occurred over the last 23,000 years.
Table 3. Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.Sequence Variation of Ancient, Anatomically Modern Humans (33)
[th]Genetic material found in mitochondria, the organelles that generate energy for the cell.
Code: [Select]
mtDNA
Code: [Select]
Sample (Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.
Code: [Select]
HVR1)[/th]
[th]
Code: [Select]
Age
      (ka)
[/th]
[th]
Code: [Select]
Sequence Number (Read Down)
Code: [Select]
00111111111111111222222222222222222222222222233333333333333
      79001122345668889001223344444555566677888899901112345556688
      83781269984393499198340413479368923448467803911780715672817
[/th]

Code: [Select]
Modern Human
Code: [Select]
0
Code: [Select]
ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA

Code: [Select]
Aboriginal
Code: [Select]
0
Code: [Select]
......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C...

The common name for Pan paniscust, also known as the Pygmy Chimpanzee.
Code: [Select]
Bonobo
Code: [Select]
0
Code: [Select]
......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC..

Two living species of ape in the genus Pan, including Pan troglodytes, the Common Chimpanzee, and Pan paniscust, also known as Bonobo or Pygmy Chimpanzee.
Code: [Select]
Chimpanzee
Code: [Select]
0
Code: [Select]
....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C..

An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.
Code: [Select]
Neanderthal
Code: [Select]
#1
Code: [Select]
40
Code: [Select]
GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C...

Code: [Select]
LM3
Code: [Select]
40#
Code: [Select]
....................T.G...........CT.T....T..T......TC....G

Code: [Select]
Paglicci-25
Code: [Select]
23
Code: [Select]
...........................................................

Code: [Select]
Paglicci-12
Code: [Select]
25
Code: [Select]
....................T......................................


* Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.HVR1
 #redated from the original 62 ka estimate.


The ancient Cro-Magnon Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA and modern European Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA differed by only 2-3 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs (see Table 4). This difference is even less than that observed among modern Europeans! In contrast, these ancient modern humans differed from nearly contemporary An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals by an average of 24 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs.
Table 4. Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.Sequence Variation Among Modern and Ancient Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.Hominids (37)
[th]Individual[/th]
[th]Modern Europeans[/th]
[th]An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals[/th]
[th]Mean[/th]
[th]Min.[/th]
[th]Max.[/th]
[th]s.d.[/th]
[th]Mean[/th]
[th]Min.[/th]
[th]Max.[/th]
[th]s.d.[/th]
Paglicci-252.30111.824.523282.4
Paglicci-123.20101.723.522272.4
Modern Europeans4.40182.3----
According to the authors of the study:
Quote
"Although only six Hypervariable region 1 of the D-loop of mitochondrial DNA, which ranges from nucleotide positions 16001-16570.HVR1 The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of ancient a.m.h [anatomically modern humans] and four The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of An extinct species (Homo neanderthalensis) of the genus Homo, which appeared approximately 400,000 years ago.Neandertals are available to date, the sharp differentiation among them represents a problem for any model regarding the transition from archaic to modern humans as a process taking place within a single evolving human lineage." (37)
Conclusion
There are two currently popular theories of human evolution 1) a single recent appearance of modern humans and 2) the An evolutionary theory that proposes that modern humans arose at multiple regions around the world and interbred to produce the modern human species.multiregional model, which states that modern humans evolved simultaneously on different continents. The branch of science that studies the structure and activity of macromolecules essential to life (and especially related to their genetic role).Molecular biology destroys the An evolutionary theory that proposes that modern humans arose at multiple regions around the world and interbred to produce the modern human species.multiregional model (12-22, 29-37). In addition, even the fossil evidence does not support the An evolutionary theory that proposes that modern humans arose at multiple regions around the world and interbred to produce the modern human species.multiregional model (38). Instead, all the data supports the biblical view that humanity arose in one geographical locale. Modern The branch of science that studies the structure and activity of macromolecules essential to life (and especially related to their genetic role).molecular biology tells us that modern humans arose less than 100,000 years ago (confirmed by three independent techniques), and most likely, less than 50,000 years ago (12-22). This data ties in quite well with the fossil record. Sophisticated works of art first appear in the fossil record about 40,000-50,000 years ago (39) and evidence of religious expression appears only 25,000-50,000 years ago (40, 41). Other indications of rapid changes during the Middle-Upper Paleolithic transition (35,000 to 45,000 years ago) in Europe include (42):
  • A shift in stone tool technology from predominantly "Rake" technologies to "blade" technologies, achieved by means of more economic techniques of core preparation.
  • A simultaneous increase in the variety and complexity of stone tools involving more standardization of shape and a higher degree of "imposed form" in the various stages of production.
  • The appearance of relatively complex and extensively shaped bone, antler, and ivory artifacts.
  • An increase in the rate of technological change accompanied by increased regional diversification of tool, forms.
  • The appearance of beads, pendants, and other personal ornaments made from teeth, shell, bone, stone, and ivory blanks.
  • The appearance of sophisticated and highly complex forms of representational or "naturalistic" art.
  • Associated changes in the socioeconomic organization of human groups, marked by
    • a more specialized pattern of animal exploitation, based on systematic hunting
    • a sharp increase in the overall density of human population
    • an increase in the maximum size of local residential groups
    • the appearance of more highly "structured" sites, including more evidence for hearths, pits, huts, tents, and other habitations.
Simultaneous, rapid changes in human abilities suggest replacement of previously existing Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominids with modern humans. The fact that all these events happened ~50,000 years ago precludes any possibility that previously existing Members of the biological family Hominidae, which includes all the "great apes," - extinct and extant humans, chimpanzees, gorillas, and orangutans.hominids could be our ancestors, since An extinct species of the genus Homo, which appeared approximately 1.8 million years ago. died out 300,000 years ago, and An extinct species of the genus Homo, also known as Neanderthal (or Neandertal) man, which appeared approximately 400,000 years ago.Homo neanderthalensis has been proven to be too genetically different from us to have been our ancestor (29, 30). Where does this leave the evolutionists and their descent of man theory? Well, they can always fall back on their favorite line - "the fossil record is just incomplete." Alternatively, check out Genesis 1:26 (43).
References
  • R. Lewontin 1972. The apportionment of human diversity. Evolutionary Biology 6: 381-398
  • M. Nei and A. K. Roychoudhury. 1982. Genetic relationship and evolution of human races. Evolutionary Biology 14: 1-59
  • Janczewski DN. Goldman D. O'Brien SJ. 1990. Molecular genetic divergence of An arboreal great ape belonging to the genus Pongo, consisting of two species, Pongo pygmaeus of Borneo and Pongo abelii, characterized by a reddish-brown coat, very long arms, and no tail.orangutan (Pongo pygmaeus) subspecies based on isozyme and two-dimensional gel electrophoresis. Journal of Heredity 81: 375-387
  • Gibbons, A. 1995. The mystery of humanity's missing Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations. Science 267: 35-36.
  • Pult I, Sajantila A, Simanainen J, Georgiev O, Schaffner W, Paabo S. 1994. Of or referring to the mitochondria, the organelles that generate energy for the cell.Mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences from Switzerland reveal striking homogeneity of European populations. Biol Chem Hoppe Seyler 375: 837-840
  • Wood B. 1992. Origin and evolution of the The second smallest classification name given for each biological species. Each genu can be comprised of one or more species.genus A genus within the subfamily Homininae that includes modern hu
President Harry S. Truman said: “The fundamental basis of this nation’s laws was given to Moses on the Mount.  The fundamental basis of our Bill of Rights comes from the teachings…  If we don't have the proper fundamental moral background, we will finally wind up with a totalitarian government which does not believe in rights for anybody except the state.”

P1tchBlack

  • Guest
Re: Militant Atheist?
« Reply #150 on: November 09, 2017, 03:38:15 PM »
Quote
about 1/5 of your posts are literally unreadable.

DunkingDan

  • Global Moderator
  • Hall of Fame
  • *****
  • Posts: 18289
  • Liked:
Re: Militant Atheist?
« Reply #151 on: November 09, 2017, 03:45:53 PM »


1/5th

The charts are not coming across as they should the rest is text

I will be looking into a way to solve the chart problem as sometimes it is a key to understanding the text  
President Harry S. Truman said: “The fundamental basis of this nation’s laws was given to Moses on the Mount.  The fundamental basis of our Bill of Rights comes from the teachings…  If we don't have the proper fundamental moral background, we will finally wind up with a totalitarian government which does not believe in rights for anybody except the state.”

DunkingDan

  • Global Moderator
  • Hall of Fame
  • *****
  • Posts: 18289
  • Liked:
Re: Militant Atheist?
« Reply #152 on: November 09, 2017, 04:23:36 PM »

Technically, my favorite question is: How did a guy (Noah) with no power tools build a cruise ship?
How do you know what he had or didn't have?
meanwhile how many remember this comedy classic 
https://www.youtube.com/watch?v=CgsFCyD4nEw Note not endorsing the man but this is one I'll never forget
President Harry S. Truman said: “The fundamental basis of this nation’s laws was given to Moses on the Mount.  The fundamental basis of our Bill of Rights comes from the teachings…  If we don't have the proper fundamental moral background, we will finally wind up with a totalitarian government which does not believe in rights for anybody except the state.”

P1tchBlack

  • Guest
Re: Militant Atheist?
« Reply #153 on: November 09, 2017, 04:38:05 PM »
i had that album when I was younger.

 

Associate Links/Search