header pic

Area51 Board (non-moderated) at College Football Fan Site, CFB51!!!

The 'Old' Scout-Tennessee a51 Crowd- Enjoy ROWDY discussion covering politics, religion, current events, and all things under the sun

Anyone is welcomed and encouraged to join our FREE site and to take part in our community- a community with you- the user, the fan, -and the person- will be protected from intrusive actions and with a clean place to interact.


« previous next »
Pages: 1 [2] 3 4 ... 8   Go Down
Author

Topic: Ancient human DNA shows humans did not evolve from Neandertals

 (Read 5066 times)

Temp430

  • Starter
  • *****
  • Posts: 1382
  • Liked:
Re: Ancient human DNA shows humans did not evolve from Neandertals
« Reply #14 on: November 10, 2017, 08:51:41 AM »
Neanderthals had larger brains than homo sapiens.
Logged
A decade of Victory over Penn State.

All in since 1969

steve37777

  • Starter
  • *****
  • Posts: 1955
  • Liked:
Re: Ancient human DNA shows humans did not evolve from Neandertals
« Reply #15 on: November 10, 2017, 12:03:42 PM »
Volrage, when I was a young boy, our preacher told us in our lifetime we would see an all out assault on the existence of God...I remember telling my sweet grandmother that would never happen...God was everywhere...That made no sense...

I was so wrong, and the preacher was so right.....
Logged

DunkingDan

  • Global Moderator
  • Hall of Fame
  • *****
  • Posts: 28301
  • Liked:
Of mice and men - little genetic difference!
« Reply #16 on: November 10, 2017, 01:22:17 PM »
Previous genetic studies have shown that chimpanzee and humans Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA differs by only 1.5%. This was said to be powerful evidence of common descent. Scientists are now sequencing the murine (mouse) genome and have come upon some rather startling data regarding a comparison of the murine and human genomes. So far, only One of the threadlike "packages" of genes and other DNA in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes. Humans have 23 pairs of chromosomes, 46 in all: 44 autosomes and two sex chromosomes. Each parent contributes one chromosome to each pair, so children get half of their chromosomes from their mothers and half from their fathers.chromosome 16 has been fully Determining the order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequenced in both species. However, the results show that human and murine Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA differ from each other by only 2.5%. This is very surprising, since, according the evolutionary theory, the two species diverged 90 million years ago. The problem for the theory of evolution is that this small difference between mice and humans makes the difference between humans and chimpanzees look huge. Whereas it took 90 million years of evolution to produce 2.5% difference in Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, humans and chimpanzees diverge 1.5% in less than 10 million years. Why has evolution sped up so much during the evolution of An order of mammals including man, apes, monkeys, etc., often characterized by large brains and flexible hands and feet.primates? Maybe 1.5% is a really big difference?

Just 2.5% of Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA turns mice into men. New Scientist, May 30, 2002.
 R. J. Mural et al. 2002.A Comparison of Whole-Genome Shotgun-Derived Mouse One of the threadlike "packages" of genes and other DNA in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes. Humans have 23 pairs of chromosomes, 46 in all: 44 autosomes and two sex chromosomes. Each parent contributes one chromosome to each pair, so children get half of their chromosomes from their mothers and half from their fathers.Chromosome 16 and the Human Genome. Science 296: 1661.
Logged
President Harry S. Truman said: “The fundamental basis of this nation’s laws was given to Moses on the Mount.  The fundamental basis of our Bill of Rights comes from the teachings…  If we don't have the proper fundamental moral background, we will finally wind up with a totalitarian government which does not believe in rights for anybody except the state.”

DunkingDan

  • Global Moderator
  • Hall of Fame
  • *****
  • Posts: 28301
  • Liked:
Of chimps and men - more genetic difference!
« Reply #17 on: November 10, 2017, 01:23:02 PM »
Previous genetic studies have shown that chimpanzee and humans Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA differs by about 1.5%. However, this difference was determined by examining the Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pair The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence Replacement of one nucleotide in a DNA sequence by another nucleotide or replacement of one amino acid in a protein by another amino acid.substitutions within certain Determining the order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequenced Functional and physical units of heredity passed from parent to offspring. Genes are pieces of DNA, and most genes contain the information for making a specific protein.genes. Recently, the human genome was completely Determining the order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequenced and sequencing of the chimpanzee genome is well on its way. Preliminary results confirm previous results regarding Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pair Replacement of one nucleotide in a DNA sequence by another nucleotide or replacement of one amino acid in a protein by another amino acid.substitutions (estimated at 1.4%). However, sequencing reveals that Chromosomal abnormalities in which a DNA sequences are inserted into genes, disrupting the normal structure and function of those genes.insertions and deletions result in another 3.4% difference between human and chimp Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA. Therefore, the overall difference between chimp and human Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA is nearly 5%, which represents an almost insurmountable amount of rapid evolution.

Britten, R.J. 2002. Divergence between samples of chimpanzee and human Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences is 5%, counting indels. Proc. Natl. Acad. Sci. USA 99: 13633-13635.
Logged
President Harry S. Truman said: “The fundamental basis of this nation’s laws was given to Moses on the Mount.  The fundamental basis of our Bill of Rights comes from the teachings…  If we don't have the proper fundamental moral background, we will finally wind up with a totalitarian government which does not believe in rights for anybody except the state.”

DunkingDan

  • Global Moderator
  • Hall of Fame
  • *****
  • Posts: 28301
  • Liked:
Little Sequence Variation Among Ancient Anatomically Modern Humans
« Reply #18 on: November 17, 2017, 05:48:35 PM »
revious studies have shown that there are large difference in The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA between modern humans and Neanderthals. However, without a measure of the variation among ancient anatomically modern humans and between them and modern humans, the data is incomplete. The first study to examine the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence of ancient anatomically modern humans was published in 2001, examining the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of 10 ancient Australians. A summary of the HVR-1 The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence of these individuals (compared with the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, modern Aboriginal A common variation in the sequence of DNA among individuals of a species or race.polymorphism, Neanderthals, and chimpanzees) can be found in table , below. The first thing that one notices is that the The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence variation of ancient humans compared to modern humans is at most 10 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs (in LM3, the most ancient specimen). As stated previously, the average variation among population groups of modern humans is 8 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs. LM3, dated at 62,000 years old, varied the most from the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, but this variation included only three bases shared with Neanderthal specimens. Since LM3 was a contemporary (or lived even earlier than the Neanderthals Determining the order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequenced to date), it is apparent that the human genome was already nearly "modern" before Neanderthals died out. The authors of the study made a big deal about the LM3 The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence sharing similarity to a portion of One of the threadlike "packages" of genes and other DNA in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes. Humans have 23 pairs of chromosomes, 46 in all: 44 autosomes and two sex chromosomes. Each parent contributes one chromosome to each pair, so children get half of their chromosomes from their mothers and half from their fathers.chromosome 11 in modern humans (thought to have been inserted into the human genome from the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA). The authors concluded that the "loss" of the ancient Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNAvariation seen in LM3 could explain how Neanderthals do not share Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA with modern humans. Although it is certainly possible that part of Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA might find its way into the nuclear genome, it doesn't address the issue of how the variation seen in the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA of LM3 was "lost." In fact, of the ten The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence differences between LM3 and the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, five of those bases correspond to A common variation in the sequence of DNA among individuals of a species or race.polymorphisms found in modern Aboriginal people, showing that those five bases were not lost at all. This leaves only a five base difference, certainly within the range of that found among modern humans. Overall, the lack of "evolution" for humans over the last 60,000 years stands in sharp contrast to the large differences seen between modern humans and Neanderthals.
Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Sequence Variation of Ancient, Anatomically Modern Humans














Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Sample
 (HVR-1)		Age
 (ka)		Sequence Number (Read Down)
 00111111111111111222222222222222222222222222233333333333333
 7900112234566888900122334444455556667788889990111 2345556688
 8378126998439349919834041347936892344846780391178 0715672817
Modern Human0ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA
Aboriginal0......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C...
Bonobo0......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC..
Chimpanzee0....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C..
Neanderthal #130+GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C...
LM362....................T.G...........CT.T....T..T......TC....G
LM4<10.................T...........G................C............
LM150.2....................T........................T.......C....G
LM55<10...........G.......................T.......................
KS110.C............T.....T.........................CG..T........
KS78..............T.....T..................T...........C.......
KS88-15....................T.G..............TG.......C............
KS99.C..................T..............T............C.........G
KS138-15.C............T.....T....C.G.................TC............
KS169-15....................T...................T.............C..C.
* Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA HVR-1

Adcock, G.J., E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J. Peacock, and A. Thorne. 2001. Of or referring to the mitochondria, the organelles that generate energy for the cell.Mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences in ancient Australians: Implications for modern human origins. Proceedings of the National Academy of Science USA 98: 537-542 .
Logged
President Harry S. Truman said: “The fundamental basis of this nation’s laws was given to Moses on the Mount.  The fundamental basis of our Bill of Rights comes from the teachings…  If we don't have the proper fundamental moral background, we will finally wind up with a totalitarian government which does not believe in rights for anybody except the state.”

P1tchBlack

  • Guest
Re: Ancient human DNA shows humans did not evolve from Neandertals
« Reply #19 on: November 17, 2017, 06:50:07 PM »
I'm confused why you continue to post all of these articles about how chimps are different than men. What is the point?
Logged

DunkingDan

  • Global Moderator
  • Hall of Fame
  • *****
  • Posts: 28301
  • Liked:
Modern humans hands down winners over Neanderthals
« Reply #20 on: November 17, 2017, 07:05:31 PM »
Another critical anatomical difference has been found between Neanderthals and contemporary ancient humans. Wesley Niewoehner, an anthropologist at the University of New Mexico in Albuquerque has built 3D digital maps of the surfaces of the metacarpals, the bones that make up the palm of the hand, from Neanderthals and ancient humans. The shapes of the ends of the metacarpals reflect the kind of grip these creatures had. Niewhoehner's maps suggest that the smaller, slimmer hands of early modern humans were better suited to oblique grips - used when holding a complex tool with a handle, such as a hammer. Neanderthals, by comparison, were limited to grips as one has when holding a stone or baseball. Such a grip would have been powerful (you wouldn't want to shake hands with a Neanderthal), but not very dexterous. The anatomy of the Neanderthals would have prevented them from engaging in fine motor skills, such as carving and painting. The more sophisticated use of tools by early modern humans would have given them a great survival advantage over Neanderthals, possibly leading to the extinction of the Neanderthals.

Clarke, T. 2001. Relics: Early modern humans won hand over fist. Nature .
 Niewoehner, W. A. 2001. Behavioral inferences from the Skhul/Qafzeh early modern human hand remains. Proceedings of the National Academy of Sciences .
Logged
President Harry S. Truman said: “The fundamental basis of this nation’s laws was given to Moses on the Mount.  The fundamental basis of our Bill of Rights comes from the teachings…  If we don't have the proper fundamental moral background, we will finally wind up with a totalitarian government which does not believe in rights for anybody except the state.”

P1tchBlack

  • Guest
Re: Modern humans hands down winners over Neanderthals
« Reply #21 on: November 17, 2017, 07:15:59 PM »
Quote from: DunkingDan on November 17, 2017, 07:05:31 PM
Another critical anatomical difference has been found between Neanderthals and contemporary ancient humans. Wesley Niewoehner, an anthropologist at the University of New Mexico in Albuquerque has built 3D digital maps of the surfaces of the metacarpals, the bones that make up the palm of the hand, from Neanderthals and ancient humans. The shapes of the ends of the metacarpals reflect the kind of grip these creatures had. Niewhoehner's maps suggest that the smaller, slimmer hands of early modern humans were better suited to oblique grips - used when holding a complex tool with a handle, such as a hammer. Neanderthals, by comparison, were limited to grips as one has when holding a stone or baseball. Such a grip would have been powerful (you wouldn't want to shake hands with a Neanderthal), but not very dexterous. The anatomy of the Neanderthals would have prevented them from engaging in fine motor skills, such as carving and painting. The more sophisticated use of tools by early modern humans would have given them a great survival advantage over Neanderthals, possibly leading to the extinction of the Neanderthals.

Clarke, T. 2001. Relics: Early modern humans won hand over fist. Nature .
 Niewoehner, W. A. 2001. Behavioral inferences from the Skhul/Qafzeh early modern human hand remains. Proceedings of the National Academy of Sciences .
Right. Neanderthals and Homo Sapiens were different  species, so they likely  would be....
.different.
Logged

DunkingDan

  • Global Moderator
  • Hall of Fame
  • *****
  • Posts: 28301
  • Liked:
Another blow to multiregional evolutionary theory
« Reply #22 on: November 19, 2017, 06:34:09 PM »
The multiregional evolutionary theory claims that humans are descended from multiple hominid forms (Neanderthals, Homo erectus, etc.). Recently, proponents of this theory have claimed that fossils show that an archaic Homo erectus from Java shared key features with living Asians and early modern humans in Australia. Their conclusion was that Asian H. erectus passed on some of its Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA to modern Australians and Asians (Science, 12 January 2001, p. 293 ). A recent genetic analysis of Asians, however, explodes this theory. The study, examining more than 1000 Asian men, determined that all of these men came from one source, between 35,000 and 89,000 years ago. The study is so convincing that some multiregional evolutionists have now dropped this theory. At the annual meeting of physical anthropologists in Kansas City, Missouri, one self-described "dedicated multiregionalist," Vince Sarich of the University of California, Berkeley, admitted: 
Quote
"I have undergone a conversion--a sort of epiphany. There are no old Y chromosome lineages [in living humans]. There are no old Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA lineages. Period. It was a total replacement."

Gibbons, A. 2001. Modern Men Trace Ancestry to African Migrants. Science 292: 1051-1052.
 Yuehai Ke, et al. 2001. African Origin of Modern Humans in East Asia: A Tale of 12,000  One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosomes. Science 292: 1151-1153.
Logged
President Harry S. Truman said: “The fundamental basis of this nation’s laws was given to Moses on the Mount.  The fundamental basis of our Bill of Rights comes from the teachings…  If we don't have the proper fundamental moral background, we will finally wind up with a totalitarian government which does not believe in rights for anybody except the state.”

P1tchBlack

  • Guest
Re: Another blow to multiregional evolutionary theory
« Reply #23 on: November 19, 2017, 09:07:40 PM »
Quote from: DunkingDan on November 19, 2017, 06:34:09 PM
The multiregional evolutionary theory claims that humans are descended from multiple hominid forms (Neanderthals, Homo erectus, etc.). Recently, proponents of this theory have claimed that fossils show that an archaic Homo erectus from Java shared key features with living Asians and early modern humans in Australia. Their conclusion was that Asian H. erectus passed on some of its Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA to modern Australians and Asians (Science, 12 January 2001, p. 293 ). A recent genetic analysis of Asians, however, explodes this theory. The study, examining more than 1000 Asian men, determined that all of these men came from one source, between 35,000 and 89,000 years ago. The study is so convincing that some multiregional evolutionists have now dropped this theory. At the annual meeting of physical anthropologists in Kansas City, Missouri, one self-described "dedicated multiregionalist," Vince Sarich of the University of California, Berkeley, admitted:
Gibbons, A. 2001. Modern Men Trace Ancestry to African Migrants. Science 292: 1051-1052.
 Yuehai Ke, et al. 2001. African Origin of Modern Humans in East Asia: A Tale of 12,000  One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosomes. Science 292: 1151-1153.
This is going to be a major blow to Mormons who believe the Garden of Eden is somewhere in Missouri.
Logged

DunkingDan

  • Global Moderator
  • Hall of Fame
  • *****
  • Posts: 28301
  • Liked:
Care to respond to the post in context?
« Reply #24 on: November 19, 2017, 10:06:00 PM »

Are you capable? :34:
Logged
President Harry S. Truman said: “The fundamental basis of this nation’s laws was given to Moses on the Mount.  The fundamental basis of our Bill of Rights comes from the teachings…  If we don't have the proper fundamental moral background, we will finally wind up with a totalitarian government which does not believe in rights for anybody except the state.”

P1tchBlack

  • Guest
Re: Care to respond to the post in context?
« Reply #25 on: November 19, 2017, 10:08:45 PM »
Quote from: DunkingDan on November 19, 2017, 10:06:00 PM
Are you capable? :34:
Capable  of acknowledging reality?  Yes...  you should  join the party.
Logged

DunkingDan

  • Global Moderator
  • Hall of Fame
  • *****
  • Posts: 28301
  • Liked:
pitch continues to play the thread hijacking troll
« Reply #26 on: November 19, 2017, 10:15:02 PM »
Quote from: P1tchBlack on November 19, 2017, 10:08:45 PM
 

Did not think you could discuss the actual post
Face it your not here to have a discussion on anything anybody posts you just being an ass to be an ass :34:
Logged
President Harry S. Truman said: “The fundamental basis of this nation’s laws was given to Moses on the Mount.  The fundamental basis of our Bill of Rights comes from the teachings…  If we don't have the proper fundamental moral background, we will finally wind up with a totalitarian government which does not believe in rights for anybody except the state.”

P1tchBlack

  • Guest
Re: pitch continues to play the thread hijacking troll
« Reply #27 on: November 19, 2017, 10:31:36 PM »
Quote from: DunkingDan on November 19, 2017, 10:15:02 PM
Did not think you could discuss the actual post
Face it your not here to have a discussion on anything anybody posts you just being an ass to be an ass :34:
Just because you don't like what I'm saying, doesn't mean I don't want to discuss topics.  You just revert to (more) personal attacks because you can't defend your positions.
Logged
Pages: 1 [2] 3 4 ... 8   Go Up
« previous next »
 
Support the Site!
Purchase of every item listed here DIRECTLY supports the site.
Hand Made Carved Door Slab

Single 8″ Printed Tile in Sapele